Busch Lab

ZMP

fgg

Ensembl ID:
ENSDARG00000037281
ZFIN ID:
ZDB-GENE-040426-1998
Description:
fibrinogen gamma polypeptide [Source:RefSeq peptide;Acc:NP_998219]
Human Orthologue:
FGG
Human Description:
fibrinogen gamma chain [Source:HGNC Symbol;Acc:3694]
Mouse Orthologue:
Fgg
Mouse Description:
fibrinogen gamma chain Gene [Source:MGI Symbol;Acc:MGI:95526]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa6585 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6585
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054230 Nonsense 70 431 3 9
ENSDART00000127889 Nonsense 70 291 3 10

The following transcripts of ENSDARG00000037281 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 24535693)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 24987464
GRCz11 1 25678293
KASP Assay ID:
554-4978.1 (used for ordering genotyping assays)
KASP Sequence:
GAGGTACAAGCCTGATATGGACAAAAAGCTGGATGATAWGGAACAGGATT[T/A]GGAAGAGATCGCCAACCTCACCAGAGGAGCTCAAGACAAAGTGGTCTACC
Long Flanking Sequence:
TGCATGTCAATGTGTACAGGTTTCAGCATTCTTCTAAATATCTTGTTTTGTATTAACAAGAAGAAAGAAACTCATAAGAGTTCAGAACCACCTGAGTGTGAGGAGCGTTGAGGAATTATTTACTAAACTGTTTTCTCAATTTCTGTTATGACTTTCTATTGTGATGATCTCCCTATAGACATTCTACTGACTAAAAGTAACAATATAATTAGTTTGCAAGCACAGGTCAACCAATTAAAATAAGTATTTACCAGTCTCCCATTACTGTACTAATCATATGAGAATTAGAGATGTAGATGCACTGATATAACGTTATAATCAACAGAATGAGTTGAAGGGACGCTGATTTTTGTACGATTTTATTTCGATAGTAAGATTGACACTTGGTCTGTCCTCTGTTTCTCAGGGAACATACTGTCCAACAACATGTGGAGTCGCTGATTACTTGCAGAGGTACAAGCCTGATATGGACAAAAAGCTGGATGATATGGAACAGGATT[T/A]GGAAGAGATCGCCAACCTCACCAGAGGAGCTCAAGACAAAGTGGTCTACCTGAAAGATTCAGAAGCACAAGCACAAAAACAATCACCAGGTAGCACAATTTATCATTAATTATGATATTATTTAAGCCCTGAATGTCATAAAAATTGCCATATGGTGTAAGCATCAAGCAGAGGTAATTGCATTTGTCTAAAGCCTTAAAGAAATATTTATACAAATGAATATGTATGTGTATATTTGCACACATATGCGCAAACACATTCCTTGATTCATTTTCCTTTGGCTCAGTCCCTGATTTATCAGAAGTCACCACATATATAGAGTATACACTTACCGGCCACTTTATTAGGTACACATTACTAGTCCCACGTTGGACCCCCTTTTGCCTTATTCCTTCATGGCATAGGTTCAACAAGGTTCTGAGAATAAGGTACTGGAAACAAGGTACTGCAAATATGGAAATATGGAAATATACTGGAAATATTGCTCAGAGATTTTGTTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3375
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054230 Essential Splice Site 171 431 5 9
ENSDART00000127889 Essential Splice Site 171 291 5 10

The following transcripts of ENSDARG00000037281 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 24533409)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 24985180
GRCz11 1 25676009
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAAAGAGCCCTGCAAAGACACTGTGGAGATTCAGACAGTCACTGGCAAAG[G/A]YAAAGATTTAAACTTGAGCAAAATTCATGTTTATGACAATTGACATGCAT
Long Flanking Sequence:
AACCCATGCAAACATGCAAACTCCACAGAGAAATCCCAGCTGGTCCAACAGGGACTCACTAGTGCTTACCACTGAGCCACCGTGCCACCCCACAAAATCATTTTATCGTTTACCAAATTTGTTATTTTTCAGTACCTGTGAACCTTAATTTTCTTTACCATCTTTTTGTCAGATACTTACATAAAAAAGTCTTCAAATATGCTGGATGATATACTACGATTTGAGAAGAGCATTCTCGCTCAGGAAGAACAAATATAGTAAGCAAATTTCCTTCTCATCTATATTATAGTGTATAAAAAAGTGAATTAAAAATCATGATGTAAAAATATATTATTCCATTAAAATATACATTTCCATATTTCTCCACAGTCAACTGCAGTCAGTCCTTCAAGCTAACGAGAAAAAAATAACGGATTTAAAGCAGATGTCTATGCAGCTGGACCAAATGTGCAAAGAGCCCTGCAAAGACACTGTGGAGATTCAGACAGTCACTGGCAAAG[G/A]TAAAGATTTAAACTTGAGCAAAATTCATGTTTATGACAATTGACATGCATACAGTGTATACAGTATATATTAGTTTACTTTGCTTAAAGGACCCATAAAGTGCTTTGAAATGTGCAATTTTTTGATGTTTGACGTAATCTCAAATATGAATAGAGGGTGGGGTATAGTTGCTCCTCCCCTTCAAAAACAAGAGCATTTTGTTATCTCACACCACTTCCAGTGAGAGTGCTTGAGCTCAAGGGCAACAAATGAAAAGCAAATGAAAGACCTCTTGAAGGGGGTGGGGCATGTCAGATACTAGAAAGCATTTGATTGGTCAAGATTTGATGAGAAACTGAAGTATGAGGTTACGTCAAAAAAGGGTTATTCCATTTATAGGTATAAGTGACAAACTGCAAGCTTTTGATGTTTATATCAGGTTAATATCTTCTAAATACAAATTTTGTCACTGTTTTGGAGTAAACTAGATTATAGATTATTTTAGTTTCATGGAACTTTTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2017
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054230 Essential Splice Site 172 431 5 9
ENSDART00000127889 Essential Splice Site 172 291 5 10

The following transcripts of ENSDARG00000037281 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 24533408)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 24985179
GRCz11 1 25676008
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAAGAGCCCTGCAAAGACACTGTGGAGATTCAGACAGTCACTGGCAAAGR[T/C]AAAGATTTAAACTTGAGCAAAATTCATGTTTATGACAATTGACATGCATA
Long Flanking Sequence:
ACCCATGCAAACATGCAAACTCCACAGAGAAATCCCAGCTGGTCCAACAGGGACTCACTAGTGCTTACCACTGAGCCACCGTGCCACCCCACAAAATCATTTTATCGTTTACCAAATTTGTTATTTTTCAGTACCTGTGAACCTTAATTTTCTTTACCATCTTTTTGTCAGATACTTACATAAAAAAGTCTTCAAATATGCTGGATGATATACTACGATTTGAGAAGAGCATTCTCGCTCAGGAAGAACAAATATAGTAAGCAAATTTCCTTCTCATCTATATTATAGTGTATAAAAAAGTGAATTAAAAATCATGATGTAAAAATATATTATTCCATTAAAATATACATTTCCATATTTCTCCACAGTCAACTGCAGTCAGTCCTTCAAGCTAACGAGAAAAAAATAACGGATTTAAAGCAGATGTCTATGCAGCTGGACCAAATGTGCAAAGAGCCCTGCAAAGACACTGTGGAGATTCAGACAGTCACTGGCAAAGG[T/C]AAAGATTTAAACTTGAGCAAAATTCATGTTTATGACAATTGACATGCATACAGTGTATACAGTATATATTAGTTTACTTTGCTTAAAGGACCCATAAAGTGCTTTGAAATGTGCAATTTTTTGATGTTTGACGTAATCTCAAATATGAATAGAGGGTGGGGTATAGTTGCTCCTCCCCTTCAAAAACAAGAGCATTTTGTTATCTCACACCACTTCCAGTGAGAGTGCTTGAGCTCAAGGGCAACAAATGAAAAGCAAATGAAAGACCTCTTGAAGGGGGTGGGGCATGTCAGATACTAGAAAGCATTTGATTGGTCAAGATTTGATGAGAAACTGAAGTATGAGGTTACGTCAAAAAAGGGTTATTCCATTTATAGGTATAAGTGACAAACTGCAAGCTTTTGATGTTTATATCAGGTTAATATCTTCTAAATACAAATTTTGTCACTGTTTTGGAGTAAACTAGATTATAGATTATTTTAGTTTCATGGAACTTTTAT
Associated Phenotype:
Not determined