Busch Lab

ZMP

si:ch73-34b5.1

Ensembl ID:
ENSDARG00000037276
ZFIN ID:
ZDB-GENE-080225-36
Human Orthologue:
MAP9
Human Description:
microtubule-associated protein 9 [Source:HGNC Symbol;Acc:26118]
Mouse Orthologue:
Mtap9
Mouse Description:
microtubule-associated protein 9 Gene [Source:MGI Symbol;Acc:MGI:2442208]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa32682 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa32681 Nonsense Mutation detected in F1 DNA Not yet available
sa38267 Nonsense Mutation detected in F1 DNA Not yet available
sa1974 Essential Splice Site F2 line generated Not yet available
sa11352 Nonsense Available for shipment Available now
sa8871 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa32682
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054225 Essential Splice Site 269 678 3 13
ENSDART00000133937 Essential Splice Site 269 678 4 14
Genomic Location (Zv9):
Chromosome 1 (position 24605406)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25057177
GRCz11 1 25748006
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCTGTTCCTCAACCCAGGGAAAGAACTGTTAAATCAAAATCGTCAGCAG[G/A]TTAGACCAGACATTTTAAAATTTTGCTAATTTTTTTATTTAAAATTAAGT
Long Flanking Sequence:
CAAAAAAGTCTCTTTCATGAAAACCAAAAGGACCAGCTCACCTCTACACTTTGAACAGTCAAACTCAGCGGGAAGTGCAGACGGCCAGTGTAGTTCTGTTCATTCCAGCCAGCCCAGGAATTCATCTCAAAGCCCAAGCAACTCTTACACTCCAGAGAAAAATCAACAGTCAGATTCCCCTTTTTCCTCTTTATCTGATAAATATCTACCTGAGTCCACTTTACTCAAGAATGATGAACAGTCGAAATCAGCAGTGCGGCTGAGGAACCAGACAGAATCTTCTATGGTGAGGAAGAGCCTATCAGAATCTCCACTGCCACTAAACTCTGAGAACAGTCAGTGGGATTCGTCCATACCTTTTACATCAGAAGGCTCACAGTGGGACAGTCCAGTGCCATTGCCTTCAGAAAAACATGAAGACAACCAGAAGATTGAGAAAGATGATGAAGTGCCTGTTCCTCAACCCAGGGAAAGAACTGTTAAATCAAAATCGTCAGCAG[G/A]TTAGACCAGACATTTTAAAATTTTGCTAATTTTTTTATTTAAAATTAAGTTTTCAACCGTGTTTGTGTGTTTTTTTCAATAGAACAGCATTTATTTTTTCAATAATTTAAAATCATTTTGTACAGTATGACTAGTGTTTACGATCACTGTTTAACAATTGAATGTAGTTTTGCTGAATTAAAGAATCCTTTATTTCTTTTTTTGTTCTTTATTTTCAAACGGCGGTAACATCAAAGCAAAAAAATAAGATTTTTTAAATTAAAAATGCTATCACAAAGTGTGTAGCGTTTCAAGCACACCGGCTTTTTATCAAACAGTATTCATCATAGCAAGTTACTCTTTTTATACACTCTTTTTATACACAACGGATCACATGATCTCAAACAGTATCTCACAACAAAAAATGTAAAAATACGCATTAGTATATTACACAACTTACATATTCAAAACGAAAATACAAAAACAAATCCTAATAATACAAACAGAATATAAAAAAAGAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25579
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054225 Essential Splice Site 270 678 3 13
ENSDART00000133937 Essential Splice Site 270 678 4 14
Genomic Location (Zv9):
Chromosome 1 (position 24605405)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25057176
GRCz11 1 25748005
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTGTTCCTCAACCCAGGGAAAGAACTGTTAAATCAAAATCGTCAGCAGG[T/C]TAGACCAGACATTTTAAAATTTTGCTAATTTTTTTATTTAAAATTAAGTT
Long Flanking Sequence:
AAAAAAGTCTCTTTCATGAAAACCAAAAGGACCAGCTCACCTCTACACTTTGAACAGTCAAACTCAGCGGGAAGTGCAGACGGCCAGTGTAGTTCTGTTCATTCCAGCCAGCCCAGGAATTCATCTCAAAGCCCAAGCAACTCTTACACTCCAGAGAAAAATCAACAGTCAGATTCCCCTTTTTCCTCTTTATCTGATAAATATCTACCTGAGTCCACTTTACTCAAGAATGATGAACAGTCGAAATCAGCAGTGCGGCTGAGGAACCAGACAGAATCTTCTATGGTGAGGAAGAGCCTATCAGAATCTCCACTGCCACTAAACTCTGAGAACAGTCAGTGGGATTCGTCCATACCTTTTACATCAGAAGGCTCACAGTGGGACAGTCCAGTGCCATTGCCTTCAGAAAAACATGAAGACAACCAGAAGATTGAGAAAGATGATGAAGTGCCTGTTCCTCAACCCAGGGAAAGAACTGTTAAATCAAAATCGTCAGCAGG[T/C]TAGACCAGACATTTTAAAATTTTGCTAATTTTTTTATTTAAAATTAAGTTTTCAACCGTGTTTGTGTGTTTTTTTCAATAGAACAGCATTTATTTTTTCAATAATTTAAAATCATTTTGTACAGTATGACTAGTGTTTACGATCACTGTTTAACAATTGAATGTAGTTTTGCTGAATTAAAGAATCCTTTATTTCTTTTTTTGTTCTTTATTTTCAAACGGCGGTAACATCAAAGCAAAAAAATAAGATTTTTTAAATTAAAAATGCTATCACAAAGTGTGTAGCGTTTCAAGCACACCGGCTTTTTATCAAACAGTATTCATCATAGCAAGTTACTCTTTTTATACACTCTTTTTATACACAACGGATCACATGATCTCAAACAGTATCTCACAACAAAAAATGTAAAAATACGCATTAGTATATTACACAACTTACATATTCAAAACGAAAATACAAAAACAAATCCTAATAATACAAACAGAATATAAAAAAAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32681
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054225 Nonsense 377 678 6 13
ENSDART00000133937 Nonsense 377 678 7 14
Genomic Location (Zv9):
Chromosome 1 (position 24603397)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25055168
GRCz11 1 25745997
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATGGATTTTTCATTATAGCTGCCACAGAAGAGAGCAAAGAGAGAAATTA[T/A]TCTACATCCTTTGAAGAAAAGCCTGTAAGTCAGATGAAGTGTGAAAATGT
Long Flanking Sequence:
CTCTGAGAAGAGTCAAGCCTCTACCAATGAATGTACAAGTGTACAGGTAAAAAATATAGTAAATCAGAGAAATAGAAGACATACAATTAAAGAAAATGCATTTAAACTGTTTAAAATACTAAAACACAAGTGAGAGATCTGTTTTACAATTTCCAAGAATTAATAAATCTGGTTCAAGCTGATGTTTTGACAGACCCTTTCTTTTTTTTAACTGTGCTTTAGGGTCCAGATGGAGACCAAGCCATGACAGAAAGATCGTTTTTATCATCAGAGCAACTATCTGAAAATCTAGCCACTGCTGGCAGTGGTATGTAAAAAAAAAACTACAACAAAAAAAAGCGTTTTATTGTTTAGAATAGTATTGAGATTATATTTTGGTTTTAGGTATTGGTGACCTGTGACAGATGACAATTTATAATAGTTAAACAGTTATTAATAACTTTGTATGTCTATGGATTTTTCATTATAGCTGCCACAGAAGAGAGCAAAGAGAGAAATTA[T/A]TCTACATCCTTTGAAGAAAAGCCTGTAAGTCAGATGAAGTGTGAAAATGTTTTATTATTATTAATATTATGATTCTTATTATTAAAGATCCCCTATTACGGGTTTTGAAAATGACCTTCCATGCAGTGTGTAACACATCTCTTCAAGAGTTCACACTTAGCTGATGATTGATTATAAAGCTTGTTTGGCATGCTGTCCCATGAAAGAGCCCTGAGCTCATAAAATCCTCGAGCCGTTTGCAAAGCGAGAGGGGAGTTTAAGCTCAGGAAGATCTCAAGAACTCCCCTGCTGTAGTAGCTAATGAACAGATAGTGATTGCTCTTAAGAGATAAATACTTACTAGGAGCATGTCTATGGTGCCAATTTGGATTAGCCAATTAACATAAGTTAATGTTAACATAAGTTGGATGTAATTGGATGGTGGGAGGAAACCAGGGGAGCATGGGGAGAACGTATAAACTCTGCACATAAACGTCGGCTGGCTTGGTAAGGACTAGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38267
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054225 Nonsense 423 678 8 13
ENSDART00000133937 Nonsense 423 678 9 14
Genomic Location (Zv9):
Chromosome 1 (position 24600415)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25052186
GRCz11 1 25743015
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCTTTAGGCCTTCAAGCTCTCAGTCAACCAGTTCCAGAAAGTCCAAGTG[T/A]TCTTATAAAGCAGAGTCCAAATACTTGGGAACACTGAAAATTTTGGATCA
Long Flanking Sequence:
TCTCAGTGCATTGACAACAGAAATAAAACATTTTAATCTTTAAATTTGAGTTAAACAGGACCTTTGAATTTTTAAACACTTTAAAAATAAACATCAAACCTGTAACATTTTTATTTGACTAATAACTCAATTAAAGACATTTTATTGAAATCAGAGATATTTCTAGACAATATGCAAAGTAGTTATATTAATCAAGCAATACATTTAGTTTTTTAAATGTAACCATTAGACTGTCAGCAAGATATCACTGCTATAAAATTTATAATATCATAAACATGCTGTATTGAAACCATATTAAACTAACAACTATCTGTTTTTAACTATTCTGCTAAATACTACAGTATGTTAATTGTTTAAAATGTTTTAAAGATGAAAAAATCCTCACTTTACATGTAACTATAGAGTGTTACTGAAATTCATTCAATAAACATTGTAAACTGAAATATTTTGGGCTTTAGGCCTTCAAGCTCTCAGTCAACCAGTTCCAGAAAGTCCAAGTG[T/A]TCTTATAAAGCAGAGTCCAAATACTTGGGAACACTGAAAATTTTGGATCAGAGAACACAGAAGGCCCAACAGGTTCCAGAAGCAGCAGATTCACTAAGAGCAGCTGTCTACCAGGTTAGACGCTTACTAAAACATTATTACTTTAAAGGACATGTAGAGACTGGCCGTTATTGTTTTAATGGGGAAAAAGATTTTAATGCATCTAACATTTGTTTGAAAAATAACAGGAATGGCTGAAAAAGAAAGAAGAAACCTTGGAAATTACTAGGAGGGCAAAAAAGCAGGAACAGAAAATGAAAGAGGAGAAAATGCAAGAGGTAATTAAGATGTTCAATATAAATTTCTTCTCTAGATCATTCATTCATTCATTTTCTTTTCGGCTTAGTCTCTTTATTAATTCGGGGTCGCCATAGCGGAATGAACCGCCAACTTATCCAGCACGTTTTTTGCGCAGCAAATGCCCTTCCAGCCGCAACCCATCTCTGGGAAACAATCACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1974
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054225 Essential Splice Site 462 678 9 13
ENSDART00000133937 Essential Splice Site 462 678 10 14
Genomic Location (Zv9):
Chromosome 1 (position 24600189)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25051960
GRCz11 1 25742789
KASP Assay ID:
554-2676.1 (used for ordering genotyping assays)
KASP Sequence:
TTAATGGGGAAAAAGATTTTAATGCATCTAACATTTGTTTGAAAAATAAC[A/T]GGAATGGCTGAAAAAGAAAGAAGAAACCTTGGAAATTACTAGGAGGGCAA
Long Flanking Sequence:
TAGACTGTCAGCAAGATATCACTGCTATAAAATTTATAATATCATAAACATGCTGTATTGAAACCATATTAAACTAACAACTATCTGTTTTTAACTATTCTGCTAAATACTACAGTATGTTAATTGTTTAAAATGTTTTAAAGATGAAAAAATCCTCACTTTACATGTAACTATAGAGTGTTACTGAAATTCATTCAATAAACATTGTAAACTGAAATATTTTGGGCTTTAGGCCTTCAAGCTCTCAGTCAACCAGTTCCAGAAAGTCCAAGTGTTCTTATAAAGCAGAGTCCAAATACTTGGGAACACTGAAAATTTTGGATCAGAGAACACAGAAGGCCCAACAGGTTCCAGAAGCAGCAGATTCACTAAGAGCAGCTGTCTACCAGGTTAGACGCTTACTAAAACATTATTACTTTAAAGGACATGTAGAGACTGGCCGTTATTGTTTTAATGGGGAAAAAGATTTTAATGCATCTAACATTTGTTTGAAAAATAAC[A/T]GGAATGGCTGAAAAAGAAAGAAGAAACCTTGGAAATTACTAGGAGGGCAAAAAAGCAGGAACAGAAAATGAAAGAGGAGAAAATGCAAGAGGTAATTAAGATGTTCAATATAAATTTCTTCTCTAGATCATTCATTCATTCATTTTCTTTTCGGCTTAGTCTCTTTATTAATTCGGGGTCGCCATAGCGGAATGAACCGCCAACTTATCCAGCACGTTTTTTGCGCAGCAAATGCCCTTCCAGCCGCAACCCATCTCTGGGAAACAATCACACACGTTCATTTATACTCCTACACAACGGACAATTTAGCCTACCCAATTCACCTGTACCACATCTCTTTGGACTGTGGGGGAAACCGGAGCACCCGGAGGAAACCCACGAACGCAGGGAGAACATGCAAACTCCACACAGAAACGCCAACTGACCCAGCTGAGGCTCGAACCAGCGACTTTCTTGCTGTGAGGTGACAGCACTACCTACTACGCCACTGCAGCGCCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11352
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054225 Nonsense 510 678 10 13
ENSDART00000133937 Nonsense 510 678 11 14
ENSDART00000054225 Nonsense 510 678 10 13
ENSDART00000133937 Nonsense 510 678 11 14
Genomic Location (Zv9):
Chromosome 1 (position 24599558)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25051329
GRCz11 1 25742158
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCTTTCTAAAACTRCAGATGCAAAGGCCTCTTATGATGCCTGGAAAGAG[A/T]AAAAACGTGACGTCATAAGAAAGAAACTCAGCGAAAAACAGAAGCTAATC
Long Flanking Sequence:
TTCATTCATTCATTTTCTTTTCGGCTTAGTCTCTTTATTAATTCGGGGTCGCCATAGCGGAATGAACCGCCAACTTATCCAGCACGTTTTTTGCGCAGCAAATGCCCTTCCAGCCGCAACCCATCTCTGGGAAACAATCACACACGTTCATTTATACTCCTACACAACGGACAATTTAGCCTACCCAATTCACCTGTACCACATCTCTTTGGACTGTGGGGGAAACCGGAGCACCCGGAGGAAACCCACGAACGCAGGGAGAACATGCAAACTCCACACAGAAACGCCAACTGACCCAGCTGAGGCTCGAACCAGCGACTTTCTTGCTGTGAGGTGACAGCACTACCTACTACGCCACTGCAGCGCCCTCTTTTCCACTTAATACAGTGAAAGTTTTCAGAATCCTTTGTAAGGTTTATTAAATATGCATATTGTTTCCCTTCTAGGAAAAGCTTTCTAAAACTGCAGATGCAAAGGCCTCTTATGATGCCTGGAAAGAG[A/T]AAAAACGTGACGTCATAAGAAAGAAACTCAGCGAAAAACAGAAGCTAATCAACCAACAACAAGTGGAAATGGATAAAAAACAAGAAAAAAAGGAAACAGCAAAACAGGTCTGCGTTTTCATAAAAAATATTTACAAATACAATTATTAGAAATACTTTATTAAAACAAATATGAAAGGGATCTACTTATTTATCCACTACACATTTATACATTTCCAAAAGCAGGTTTTTGAGAAGTGGAAAGAGGAGCACGACAGTATCCTTAAAGACAAGATCAGGGAAAAGAAACAGGCTGAAAGAAAGCTGAAACTACAGAAGGTCACAGAGAAAGAAGAGAGAAAGAAGGACTGCTCCTCTGCTTTCACTAAATGGTAAGAAAGACACATTTGAAATATACGGAACTTTAATTTTAGTCTTTCTCTTTTGTTAAACAGCTCTCATTTGGTTATGCTCAAGCCACTCAGCAATTATGTATTGATTAAAATGTAAATGAGCTCTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8871
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054225 Nonsense 510 678 10 13
ENSDART00000133937 Nonsense 510 678 11 14
ENSDART00000054225 Nonsense 510 678 10 13
ENSDART00000133937 Nonsense 510 678 11 14
Genomic Location (Zv9):
Chromosome 1 (position 24599558)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25051329
GRCz11 1 25742158
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCTTTCTAAAACTRCAGATGCAAAGGCCTCTTATGATGCCTGGAAAGAG[A/C]AAAAACGTGACGTCATAAGAAAGAAACTCAGCGAAAAACAGAAGCTAATC
Long Flanking Sequence:
TTCATTCATTCATTTTCTTTTCGGCTTAGTCTCTTTATTAATTCGGGGTCGCCATAGCGGAATGAACCGCCAACTTATCCAGCACGTTTTTTGCGCAGCAAATGCCCTTCCAGCCGCAACCCATCTCTGGGAAACAATCACACACGTTCATTTATACTCCTACACAACGGACAATTTAGCCTACCCAATTCACCTGTACCACATCTCTTTGGACTGTGGGGGAAACCGGAGCACCCGGAGGAAACCCACGAACGCAGGGAGAACATGCAAACTCCACACAGAAACGCCAACTGACCCAGCTGAGGCTCGAACCAGCGACTTTCTTGCTGTGAGGTGACAGCACTACCTACTACGCCACTGCAGCGCCCTCTTTTCCACTTAATACAGTGAAAGTTTTCAGAATCCTTTGTAAGGTTTATTAAATATGCATATTGTTTCCCTTCTAGGAAAAGCTTTCTAAAACTGCAGATGCAAAGGCCTCTTATGATGCCTGGAAAGAG[A/C]AAAAACGTGACGTCATAAGAAAGAAACTCAGCGAAAAACAGAAGCTAATCAACCAACAACAAGTGGAAATGGATAAAAAACAAGAAAAAAAGGAAACAGCAAAACAGGTCTGCGTTTTCATAAAAAATATTTACAAATACAATTATTAGAAATACTTTATTAAAACAAATATGAAAGGGATCTACTTATTTATCCACTACACATTTATACATTTCCAAAAGCAGGTTTTTGAGAAGTGGAAAGAGGAGCACGACAGTATCCTTAAAGACAAGATCAGGGAAAAGAAACAGGCTGAAAGAAAGCTGAAACTACAGAAGGTCACAGAGAAAGAAGAGAGAAAGAAGGACTGCTCCTCTGCTTTCACTAAATGGTAAGAAAGACACATTTGAAATATACGGAACTTTAATTTTAGTCTTTCTCTTTTGTTAAACAGCTCTCATTTGGTTATGCTCAAGCCACTCAGCAATTATGTATTGATTAAAATGTAAATGAGCTCTCTT
Associated Phenotype:
Not determined