Busch Lab

ZMP

si:ch211-145b13.4

Ensembl ID:
ENSDARG00000037260
ZFIN ID:
ZDB-GENE-030131-2917
Description:
Si:ch211-145b13.4 protein [Source:UniProtKB/TrEMBL;Acc:A0JMC0]
Human Orthologue:
TOPORS
Human Description:
topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase [Source:HGNC Symbol;Acc:2
Mouse Orthologues:
4930547C10Rik, Topors
Mouse Descriptions:
RIKEN cDNA 4930547C10 gene Gene [Source:MGI Symbol;Acc:MGI:1915524]
topoisomerase I binding, arginine/serine-rich Gene [Source:MGI Symbol;Acc:MGI:2146189]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa19504 Essential Splice Site Available for shipment Available now
sa19505 Nonsense Available for shipment Available now
sa1998 Nonsense F2 line generated Not yet available
sa5657 Nonsense F2 line generated Not yet available
sa39618 Nonsense Mutation detected in F1 DNA Not yet available
sa6588 Nonsense Mutation detected in F1 DNA Not yet available
sa19506 Missense Available for shipment Available now

Mutation Details

Allele Name:
sa19504
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102379 Essential Splice Site None 833 None 4
ENSDART00000121658 None None 791 None 4
ENSDART00000127154 None None 490 None 2
ENSDART00000129269 Essential Splice Site None 999 None 3
ENSDART00000141661 Essential Splice Site None 154 None 3
Genomic Location (Zv9):
Chromosome 1 (position 24987923)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25411621
GRCz11 1 26105335
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCCGATTGTCGCGTAATGATCTTTAAACCAGCACGATTGTGTTAGACAG[T/G]AAGTTACATTATTTCAGGTCATCGTGATTTTAAGAATTCTGTAATACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19505
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102379 Nonsense 182 833 3 4
ENSDART00000121658 Nonsense 166 791 1 4
ENSDART00000127154 Nonsense 182 490 1 2
ENSDART00000129269 Nonsense 182 999 3 3
ENSDART00000141661 None None 154 None 3
Genomic Location (Zv9):
Chromosome 1 (position 24989778)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25413476
GRCz11 1 26107190
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGCGAAGTCTTCAAGATCAAGAAGTGGTTAAGTTCAGACGAGCCTTGTA[C/A]AGAAGAGGTGTGCAGGTCCAAAGCGTGCAGGATGGTGGGCGTACGAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1998
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102379 Nonsense 187 833 3 4
ENSDART00000121658 Nonsense 171 791 1 4
ENSDART00000127154 Nonsense 187 490 1 2
ENSDART00000129269 Nonsense 187 999 3 3
ENSDART00000141661 None None 154 None 3
ENSDART00000102379 Nonsense 187 833 3 4
ENSDART00000121658 Nonsense 171 791 1 4
ENSDART00000127154 Nonsense 187 490 1 2
ENSDART00000129269 Nonsense 187 999 3 3
ENSDART00000141661 None None 154 None 3
Genomic Location (Zv9):
Chromosome 1 (position 24989791)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25413489
GRCz11 1 26107203
KASP Assay ID:
554-3138.1 (used for ordering genotyping assays)
KASP Sequence:
AAGATCAAGAAGTGGTTAAGTTCAGACGAGCCTTGTACAGAAGAGGTGTG[C/T]AGGTCCAAAGCGTGCAGGATGGTGGGCGTACGAGAGAGACCTCAGCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5657
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102379 Nonsense 187 833 3 4
ENSDART00000121658 Nonsense 171 791 1 4
ENSDART00000127154 Nonsense 187 490 1 2
ENSDART00000129269 Nonsense 187 999 3 3
ENSDART00000141661 None None 154 None 3
ENSDART00000102379 Nonsense 187 833 3 4
ENSDART00000121658 Nonsense 171 791 1 4
ENSDART00000127154 Nonsense 187 490 1 2
ENSDART00000129269 Nonsense 187 999 3 3
ENSDART00000141661 None None 154 None 3
Genomic Location (Zv9):
Chromosome 1 (position 24989791)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25413489
GRCz11 1 26107203
KASP Assay ID:
554-3138.1 (used for ordering genotyping assays)
KASP Sequence:
AAGATCAAGAAGTGGTTAAGTTCAGACGAGCCTTGTACAGAAGAGGTGTG[C/T]AGGTCCAAAGCGTGCAGGATGGTGGGCGTACGAGAGAGACCTCAGCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39618
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102379 Nonsense 429 833 3 4
ENSDART00000121658 Nonsense 413 791 1 4
ENSDART00000127154 Nonsense 429 490 1 2
ENSDART00000129269 Nonsense 429 999 3 3
ENSDART00000141661 None None 154 None 3
Genomic Location (Zv9):
Chromosome 1 (position 24990517)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25414215
GRCz11 1 26107929
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCCCGTGGCAGAGAGGACACCAGAACTGGTCCAGCTTTCTTCTGATTCT[G/T]AAAATTCCGAGACTGAGCAGAATGCAAGTCCACGAAACTCTCAAGCTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6588
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102379 Nonsense 598 833 3 4
ENSDART00000121658 Nonsense 549 791 3 4
ENSDART00000127154 None None 490 None 2
ENSDART00000129269 Nonsense 598 999 3 3
ENSDART00000141661 None None 154 None 3
Genomic Location (Zv9):
Chromosome 1 (position 24991024)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25414722
GRCz11 1 26108436
KASP Assay ID:
554-5104.1 (used for ordering genotyping assays)
KASP Sequence:
GTARGGACCTTCTGGACAGAAGTCGCTCAAGGAGTAATTCAAGAATAAGC[C/T]AGTCGAATCGGCGTAATAGGAGTCGCTCAAGGAGTAATTCAAGAATAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19506
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102379 Missense 651 833 4 4
ENSDART00000121658 Missense 636 791 3 4
ENSDART00000127154 None None 490 None 2
ENSDART00000129269 Missense 685 999 3 3
ENSDART00000141661 None None 154 None 3
Genomic Location (Zv9):
Chromosome 1 (position 24991286)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25414984
GRCz11 1 26108698
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGGCATAATAGAAGTTGTTCAAGGAGTTATTCAAGAACAAGCCCATTTA[A/G]TGAACGGAATAGAAGACACTCAAGGAGTAATTCTAGAAAAAGCCAATCCA
Associated Phenotype:
Not determined