Busch Lab

ZMP

si:ch211-145b13.5

Ensembl ID:
ENSDARG00000037256
ZFIN ID:
ZDB-GENE-090313-35
Human Orthologues:
KCNIP1, KCNIP2, KCNIP3, KCNIP4
Human Descriptions:
Kv channel interacting protein 1 [Source:HGNC Symbol;Acc:15521]
Kv channel interacting protein 2 [Source:HGNC Symbol;Acc:15522]
Kv channel interacting protein 3, calsenilin [Source:HGNC Symbol;Acc:15523]
Kv channel interacting protein 4 [Source:HGNC Symbol;Acc:30083]
Mouse Orthologues:
Kcnip1, Kcnip2, Kcnip3, Kcnip4
Mouse Descriptions:
Kv channel interacting protein 3, calsenilin Gene [Source:MGI Symbol;Acc:MGI:1929258]
Kv channel interacting protein 4 Gene [Source:MGI Symbol;Acc:MGI:1933131]
Kv channel-interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1917607]
Kv channel-interacting protein 2 Gene [Source:MGI Symbol;Acc:MGI:2135916]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4845
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054202 Nonsense 52 225 2 8
Genomic Location (Zv9):
Chromosome 1 (position 24900559)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25324257
GRCz11 1 26017971
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACAAGAGAGCACAACGGAACGGTATCACCCAGAAAATCTGGAGCAACTG[C/T]AATCGCAGACCCATTTCTCCAGACAAGAGCTGCAGTTACTCTATAGAGGA
Associated Phenotype:
Not determined