Busch Lab

ZMP

gpr137

Ensembl ID:
ENSDARG00000037244
ZFIN ID:
ZDB-GENE-040718-443
Description:
G protein-coupled receptor 137bb [Source:RefSeq peptide;Acc:NP_001002691]
Human Orthologue:
GPR137
Human Description:
G protein-coupled receptor 137 [Source:HGNC Symbol;Acc:24300]
Mouse Orthologue:
Gpr137
Mouse Description:
G protein-coupled receptor 137 Gene [Source:MGI Symbol;Acc:MGI:2147529]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa13832 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13832
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054183 Essential Splice Site 115 375 2 8
Genomic Location (Zv9):
Chromosome 14 (position 27449512)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26142309
GRCz11 14 26440414
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGTTTGCAGTTTTTCACCCTGAGTCTCTTCAACCTTTACTTCACTCAGG[T/C]AAGACAAGTGAAGGTTCATAAACAAAGATGTCATGTGTTTGCACAGTTGA
Long Flanking Sequence:
CAGACAAATGATAATTCATAATATTACAGTCAAACATGGCTGAGTTTTGTTTAATCATTTTACTAATATGAAATATCTTGACATTTTACACCGGTTTAGTTTACTTTTATTTTAAGGCTTTGTGTATTATATATTTTTAACATTCCTCATCACAATGCACACTTCTGTTCCACCGTCCCCCATGAGACCAGCCGTGGCCCCATCAGTGCAGTTGGGGGTCACGGTTCTCTACACCTGTCTTTATGGGGGCTTATTTCTAATCGTATACATTCAGCTTTGGCTGCTTTTACTCTTTCGACATAAACGCTGGAGCTACCAGAGTATATTTCTTTTTCTTTGCCTGTTCTGGGCTGCGCTTCGCACAACACTCTTTTCGTTTTATTTCCACGATGCCCTTGCTGCCAACCATCTGCCCACTCCGCTCTACTGGCTCCTTTATTGCTTCCCAGTTTGTTTGCAGTTTTTCACCCTGAGTCTCTTCAACCTTTACTTCACTCAGG[T/C]AAGACAAGTGAAGGTTCATAAACAAAGATGTCATGTGTTTGCACAGTTGAAGAACCAATCCACTCCCTAATAACAATATTTCATTTTGACAGGAGCTGTTCAAAGTTAGAAGTGTATTCAACATAGATCCCAGCAAAGGACTGTGAGTACTTTCACATACATCACTAATTCTCAACCTTTTTTACTCCATTGTGAATAACAGTATTCAAGGGCAAGGCCCTGAGACCTTTCTTGTTGTTTGTGATTTACTGAATAGAATAACATTCTACTTACTCACATTTTACTGAAACTACAGTTGCAAAACTATTAAACCCCCTTATTTTTTTCTTTTTGAATATTTCCCAAATGATGTTTAACAGATTCAGGACATTTTCACAGTATGTCTGAAAATATTTTTTTACTGGAGAAAGTCTTATTTGTTTTATTTCGGCTGGAATAAAAGCAGTTATTAATTTTTTAAAAACCATTTTAAGGTCAAAATTATTAGCCCCTTTAAGCTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28311
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054183 Nonsense 241 375 5 8
Genomic Location (Zv9):
Chromosome 14 (position 27454735)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26147532
GRCz11 14 26445637
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATCTTGCTCTTCTCTAGCAGGGCTTGTTACAATCTTGCGGTGCTGTTTT[T/A]GTCGAACGATCATAAAATCGAGGCCTTTGACTACGACTGGTACAACATCT
Long Flanking Sequence:
AACAGTCGAGCTGGTTTCAGTTCTTTCATTTTAATTTTATTTAAAGTATATTCATTTAACTTGTTTATTAATAAAATCTCGTTTTGTTATTTAACCCATTATTTTTATGCATCAGTCAGTTTATTTGCTAAGTGAAGAGAAGGAAATCCTTGGCAATTATTGCTTTGTTTGCTTTGAGTAGCTTGTTCTAAGACCAGTTCTCACTTTTTATGAAGTTTTTAAAATAAAATCATTTGTTCACTGTGTAAAAATATACAATTTTTAAATATTTATATTTATCGGCTAATATATCGGTTATCAACCTCCAAATTTAAGACTTATCGGTTATTGTTATCGCCCCAAAAATCCATATCGGTGCATTCTTACTGGTAACCATTGACATCCATAGTCTGTTTGTTTTGTTTTTGGCTTGCAGGATTTCTGTCGGACTGCGGTTTTGGGAGCCGGTGTGATCTTGCTCTTCTCTAGCAGGGCTTGTTACAATCTTGCGGTGCTGTTTT[T/A]GTCGAACGATCATAAAATCGAGGCCTTTGACTACGACTGGTACAACATCTCTGATCAGGTGGGCCTTTTTGTCGGAGGCTAATTGAAAAATGTTTTTTCCTGTGACTGTCAGTCTGAGAAGTTTAATGTCCTCCTTAAAGGCTGATCTTCAGAGTGAGCTAGGAGACAGAGGATACATCATCTTCGGAGTTGTTCTTTTCATATGGGAGCTGCTGCCTACCAGTCTACTTATCCTCATCTTCAGAGTTCGCCAGCCTCCGCAGGAGAAGGTGCCATTTTTGTTTGACTAATATGCTATTGTTGAAAACTGCAGAGACAGAATAATCTTTATTATATTTTTTAATTTAAGAGTCATTAGCTGTTTCCATTCACCTATTTTTATGCGAATTTTGGAAATGCGCATAAAAAATGGTTGATGGAAATGCCAAGATGCGAATTTTGAAAATGCACATAACTGAGTAGGATCAACGTTTTATTCAATAAAAAAAGATGCACATAAG
Associated Phenotype:
Not determined