Busch Lab

ZMP

ARID5B

Ensembl ID:
ENSDARG00000037196
Description:
AT rich interactive domain 5B (MRF1-like) [Source:HGNC Symbol;Acc:17362]
Human Orthologue:
ARID5B
Human Description:
AT rich interactive domain 5B (MRF1-like) [Source:HGNC Symbol;Acc:17362]
Mouse Orthologue:
Arid5b
Mouse Description:
AT rich interactive domain 5B (MRF1-like) Gene [Source:MGI Symbol;Acc:MGI:2175912]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa45451 Nonsense Mutation detected in F1 DNA Not yet available
sa35214 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa45451
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054092 Nonsense 467 1044 8 8
Genomic Location (Zv9):
Chromosome 12 (position 9136815)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 8344770
GRCz11 12 8382613
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCCCAACTCTCACACCTCGGACCAATGGAAGCATGGGATATTGGAATAC[A/T]AGGTACCTCCTAGTGCCCTTGCAAACGTTGAACAATCTAGGCCAAAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35214
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054092 Nonsense 581 1044 8 8
Genomic Location (Zv9):
Chromosome 12 (position 9137157)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 8345112
GRCz11 12 8382955
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGTCAGTAGAAGATTGTCCAGCAGTGGTACAGAAGTGTCATCTGCTGGA[C/T]AGTCGAGCTCCCAGGTTTCCTCCTCCGTAGAGACCAGCATAGTGATCAAA
Associated Phenotype:
Not determined