Busch Lab

ZMP

zgc:101084

Ensembl ID:
ENSDARG00000037182
ZFIN ID:
ZDB-GENE-040801-86
Description:
surfeit locus protein 2 [Source:RefSeq peptide;Acc:NP_001003567]
Human Orthologue:
SURF2
Human Description:
surfeit 2 [Source:HGNC Symbol;Acc:11475]
Mouse Orthologue:
Surf2
Mouse Description:
surfeit gene 2 Gene [Source:MGI Symbol;Acc:MGI:98444]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa40345 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40345
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054070 Nonsense 217 228 5 5
Genomic Location (Zv9):
Chromosome 5 (position 1529040)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 1153390
GRCz11 5 1207805
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTTCAGACTGATGAAGATGAAGAGGAAATGGAAGTAGAAAACCAGGAG[C/T]AGAAACGCAGGAAGGTTGGAGAATCACATTTATTTTATTTATAAATCTGT
Associated Phenotype:
Not determined