Busch Lab

ZMP

zgc:66359

Ensembl ID:
ENSDARG00000037177
ZFIN ID:
ZDB-GENE-040426-1619
Description:
Novel protein (Zgc:66359) [Source:UniProtKB/TrEMBL;Acc:B0S5D8]
Human Orthologues:
AC002365.1, AC003980.1, AC006062.1, AC006999.1, AC007379.1, AC008162.1, AC008573.1, AC008794.1, AC009021.1, AC010133.1, AC011503.2, AC012596.1, AC016595.1, AC022409.1, AC022486.1, AC023481.1, AC067941.1, AC092485.1, AC097714.1, AC116351.3, AC145210.1, AL121899.1, AL138690.1, AL159986.1, AL357512.1, AL591242.1, ZC3H13
Human Description:
zinc finger CCCH-type containing 13 [Source:HGNC Symbol;Acc:20368]
Mouse Orthologues:
Gm10563, Zc3h13
Mouse Descriptions:
predicted gene 10563 Gene [Source:MGI Symbol;Acc:MGI:3642630]
zinc finger CCCH type containing 13 Gene [Source:MGI Symbol;Acc:MGI:1914552]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa31208 Essential Splice Site Available for shipment Available now
sa45075 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa19512 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31208
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054064 Essential Splice Site None 1759 1 21
ENSDART00000110816 Essential Splice Site None 244 1 11
Genomic Location (Zv9):
Chromosome 1 (position 28712095)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 28962924
GRCz11 1 29766855
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATCCCCAATAGTCTGTGAAACTGGACTTGACGCATCAATCATATTCGGG[T/C]AAATTAGAATTTGTTTATGGAGCCATTAAAGGGTCCGTTTTAGCTGTATC
Long Flanking Sequence:
GGCCTTTAAAAAAAATATGATAATTAAAACATAATAATAATAATAATAATATATAATATATATATATATATAATGTGAAATGCTGCCTCTACTGGCCTCAACTCATCATAATGCGTGTCCGCATTGTTGTTTGTAACTTTATAGGTGGCTTAAACTCTTTAAATTCTTTGTTTTTTTATTTTAGAATTAAATGAACATACTTTTATCATTAAAACACAACAGGAAATAATGTCCATGTAGCCTGTGTGTGCGTTTATGTGTTCTGTCTCCAAATAACTATTTTACATTCAGGCAAACCAATTCTTCGGATTAGACCTCCAGTTTCCCACAATCCACTTCTTTGTGCTTCAGGAAGCTGAATGTGTGCAGAGTTTGCGCTGTCTTGCCAGCATCATGACGGCGGCTAAGGGGAAGACCGCTTTGCAAGACTTTTGCATGTGATTAGGAGGTTATCCCCAATAGTCTGTGAAACTGGACTTGACGCATCAATCATATTCGGG[T/C]AAATTAGAATTTGTTTATGGAGCCATTAAAGGGTCCGTTTTAGCTGTATCGTTATATAGGCTTGTGTTAACAGTGTAGGCCGCGCTGCAGTCATGCAGTTGTATAGCTTCATTCTGCAAATGAATGACCGCTTAAAACGCGCACATATATTAACTATCTTTTTTGTGTGTTTGTGTTAAGCTTCGCATGGTGCATAAATAGTTATTGTCTCAATTACGATATCGTTGATGTGCGTTGGAGAGTGTCAAGCAGATACGACTAAATGTAGTACGTTACGTTACAGCCAGTGCTGTTGTTTACAGTGTTCGGGGCTCTGTAAAATAAATGGAACATTCATGGCTTTTTGCAAGCTACAAAAGCCACGAGAATTAAATAATTATAATGTTAATTTGTGTGGATGTAGTAAATTGCCCTGCATTGATGATCAGAGACAGAATCATCCTTCAAGCTAATGTTACAATCATCGCAAGCTGTTATTTGGAGACCACATTACATAATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45075
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054064 Essential Splice Site None 1759 None 21
ENSDART00000110816 Essential Splice Site None 244 None 11
Genomic Location (Zv9):
Chromosome 1 (position 28714593)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 28965422
GRCz11 1 29769353
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACTGTAACACAGCTTTGTAATTGAAGTGATTTCTATTTATTTTTAATTC[A/G]GCCCTGCAGAATGTCCAAGATCAGGCGGAAGGTTACAGTGGAGAATTCGA
Long Flanking Sequence:
CAGCTTTTCCATGCGTTTAACATCTCAGATCATGGACTCGCAAAAGATATGTGGATGATTCATGTTACTTACACAGGCATATTCCGGATATATGTGAAAGACGCAGTGTAACGCGTTGAGTGAAAAAAATACAGGATAGCTCATCTAACTCGTGTAGCAGCAAAAAAAAAAAAGATTTATGAAAAAATAGCATGATTTCCTTCAAGTGAAACATGAGCACACATTGCTTTGCATCTTAGAAACACAACCAAGCCTTAAAATTACATTCTGTTAACCTGCAATTGTATAATATATGGTGTATATAAGGTTGTTTATATATGTATAAATGTTGGAGTTGGCATCAACTCCCTTTAAGGTTAGGTTATCATTAAAAAAAAAAAAGCTAAATTTAACCACAATTTAACCACAATTTATATATATAAATGTAAAGTTTTATGGCTCTGGGATCTTGACTGTAACACAGCTTTGTAATTGAAGTGATTTCTATTTATTTTTAATTC[A/G]GCCCTGCAGAATGTCCAAGATCAGGCGGAAGGTTACAGTGGAGAATTCGAAGACCATATCGGACAGCAGCAGTAGCACGACCACCCCCTCCCGCAGGCCCAGTGTGTTTGAGAGACTCGGGCCCAGCACGGCCAGTAATGCAGCAGAGGTACGGATTCTGGTCACCTGCTTTGATGCTCCTGATATAAAAAATCTGAATACTTAGACAGTAGGGCTGGGCGATATGACAAAAATCTCATATCATGATACAAATCATCTCATATCCTGAATCTGATAACAAAAAGTATCACAATAAAGTATCATTTCTATAAATTCAATGAATTAACAGTTTATTTTGACCACATGTAAAGCACTATTCTCATTTTACATTTTAAAATGGATATTATAGAGTTTATTCATCCATATGAGATCACATTTCTCACTTTATTAAGAACTTCAAGGCAAATGTTTGTATAAAACTGATGAAATATACTTTAAATATTAATAGCAAGTATATTAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4847
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054064 Essential Splice Site 343 1759 9 21
ENSDART00000110816 None None 244 None 11
Genomic Location (Zv9):
Chromosome 1 (position 28717734)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 28968563
GRCz11 1 29772494
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAAGAGGACGAGATGCAGAGAAGCACAAAGAGAAAAAAGAAAAGCGCAGG[T/C]ATGGTCATCTAGATTTTGTAGAAGTGTAAATTGTACAATGTCAATTTGTG
Long Flanking Sequence:
ATACAGATGTGTTATTGATCTATTTTAGGCTTCTCCTGAGCACACCAGCTCTAAAGGATCCCCATCATCTCGTAAATCTAGCGGCTCACCCAAACACAGAGGCGGGAAAGGTGGGAACCCCAGCAAGAAAGAGAAGAAGTCCTCCACTTCCTCAGTTATTTCCTCACCAGTGTCTGACCAGACGAGAGCAGAGGAGACTGACAGCAGGTTAGTGTAATATTAAGCATTTAAATTTAACTTGAAAATTAAAAGTTTATAAAATTAAAGTACTTGACTTGCTGTATAATTTTTTTAACAGGTCATCTAAGAGTGGCCATGGTAAAAGAAAAGGGCCACGGACGCCCAGTCCTCCACCCCCAGTCCCTGTGGAGAACCCAGTGGTTGGGAAAAAACACAAAAACAAACACAAGAACAAGGATAAATCTGAGGACAAAACTAAAGAAGGCAAAGAAAGAGGACGAGATGCAGAGAAGCACAAAGAGAAAAAAGAAAAGCGCAGG[T/C]ATGGTCATCTAGATTTTGTAGAAGTGTAAATTGTACAATGTCAATTTGTGAAAACATTTCTAATTAGTTATGAATATTAACATGACATATTCACCTTTATCCTTTACTTAATTGCAGGGATCGTTCAGACAGTTCCCATAAAGCCAAACGCTCAATGACCTCAGAAGAACGATCTGGAAGTCTCTCCCCACCTTCCAGGGAAGCATCTCCACCAGCCAGAAGGAAGTCATCATCTCCCAAACCCTCCTCTAAACAAGCCTCACAGCATAGGTGAGAGGAGCTGCACTTATTAAATGGTAACAAGTAAGGGTGTCTCGATTTTGATTTTAAATCGAAATCGATCGAAATTCATGCTCAATTTCGATTATCGAATGAAAAAATGGAATCGTCGATGCTGCCATGGCCCCATGTCACGTCAGCTTGGCTTGCTAAGAGGAAAAAAGACACGCTTGTTGAAGAGCTTTTTTTAAACTGCAGACGCAGGAGACCCGTCGAAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19512
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054064 Nonsense 1542 1759 18 21
ENSDART00000110816 None None 244 None 11
Genomic Location (Zv9):
Chromosome 1 (position 28737817)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 28988646
GRCz11 1 29792577
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTCTCTGTTCTTTCAGAAGAGGAAGATGGAAAAGCAGATGATGCA[C/T]AGTCTGTTGTGTCAGGTGGTGAGGAGTATGAGCCAATCAGTGACGATGAA
Long Flanking Sequence:
GAACTGAGCAAGATTTTGTTTGTCTCATGTGCTTGTATTTGTGTGTTGTTGAACTTTTTGTGCTGCCATTTTAGCCAGGACTCCCTGGAAGAAGAAATCTAGTATCTTAATGGGACTGTTCTGGTAAAATAAATAAAAATACAGGAGATGAGGTGCTATAATCAGATATGGGGGAAAGCAGTGACACAGTGAGAACATCACGTTTTATATAGTCTGAATTTCATTCATAAAACCCTCATTCGTTCTATTTAGATCATACTTTTTTTAGCTTATGGGAAGTACTTTCAAATTCAAATGTACTTGAGTAGTATGTGATTTTTGTGGATGCAGCTAATGTGTTAGCTCATAAAGATGTCAAATTGTGATGCGTAATGATTCTCAGGACCTGGATTGAAAACCACTGGCCTGTATAAATGTGGCTGTGCCAAGCATTTATTAAATTTCATACATTTTTTTTCTCTGTTCTTTCAGAAGAGGAAGATGGAAAAGCAGATGATGCA[C/T]AGTCTGTTGTGTCAGGTGGTGAGGAGTATGAGCCAATCAGTGACGATGAACTTGATGAGATTCTGGCAGACAGTCAGAAGAGGGACGAGCAGCAAGATGATGAAAAGACTTCTGGTAAGTAACACTAGCACAACCTAAAGCAGAAAAAACACAAAATTAAATAAAGTCACAGCACAGTTTCATGAACTGAAATGCACTATTCGTAGAATGAAATGAAAGCTCTGTAACTGTTTTGTGCCATGGTATATCAACGTTTCTATCCATTTAACTAAAATCATCATGTCCCTTCAACTAAAAAGTCATGATATGGTTAGTGTTTGTCATATTTCAAAAGACTGGGGGTAAATACTAGTGTTGGGTATCATTTGAAATTGATCAATTCCCATTTCAATTCTTAAACTAATTCTCAGTATTGATTCTTATAGATTCCCAGTTCTGATTTCAATGTAGTAAAAAAGATGAATTATTAACAGAAAGGAAAAGTCAAACATTTAGGCCCT
Associated Phenotype:
Not determined