Busch Lab

ZMP

slc8a4b

Ensembl ID:
ENSDARG00000037145
ZFIN ID:
ZDB-GENE-050809-103
Description:
solute carrier family 8 (sodium/calcium exchanger), member 4b [Source:RefSeq peptide;Acc:NP_0011167
Human Orthologue:
SLC8A1
Human Description:
solute carrier family 8 (sodium/calcium exchanger), member 1 [Source:HGNC Symbol;Acc:11068]
Mouse Orthologue:
Slc8a1
Mouse Description:
solute carrier family 8 (sodium/calcium exchanger), member 1 Gene [Source:MGI Symbol;Acc:MGI:107956]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa34209 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa34209
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054007 Nonsense 528 925 3 8
Genomic Location (Zv9):
Chromosome 7 (position 60675662)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 59894627
GRCz11 7 60199864
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCCCTAGTGCTGCCCTTGGTGAGGCTCACACGGCAACAGTGACAATCTA[T/A]GATGATGACCATGCCGGAATTTTCACATTTGAGAGTGAATCAATGCGAGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8289
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054007 Nonsense 754 925 7 8
Genomic Location (Zv9):
Chromosome 7 (position 60714036)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 59933001
GRCz11 7 60238238
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTCTCTTTGCCTTTGTCCCACCTACAGAGTACTGGAATGGATGGGCTTG[C/A]TTCATTGTTTCCATCTTTTTRATCGGTGCRTTGACAGCGGTCACTGGTGA
Associated Phenotype:
Not determined