Busch Lab

ZMP

cpb2

Ensembl ID:
ENSDARG00000037144
ZFIN ID:
ZDB-GENE-050522-259
Description:
carboxypeptidase B2 [Source:RefSeq peptide;Acc:NP_001018539]
Human Orthologue:
CPB2
Human Description:
carboxypeptidase B2 (plasma) [Source:HGNC Symbol;Acc:2300]
Mouse Orthologue:
Cpb2
Mouse Description:
carboxypeptidase B2 (plasma) Gene [Source:MGI Symbol;Acc:MGI:1891837]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa6593 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6593
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054059 Nonsense 121 424 4 11
ENSDART00000101856 Nonsense 121 355 4 10
Genomic Location (Zv9):
Chromosome 1 (position 28706654)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 28957483
GRCz11 1 29761414
KASP Assay ID:
554-4583.1 (used for ordering genotyping assays)
KASP Sequence:
ATGCAGATCAGAAATGATACATCAGATCCCCGAAGCGGAGGCGTCTTYTA[T/A]GAGAGATATCWTTCCTTAGAAGATGTAAACAAAAAAAATCACTTTAACAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25596
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054059 Nonsense 353 424 10 11
ENSDART00000101856 Nonsense 284 355 9 10
Genomic Location (Zv9):
Chromosome 1 (position 28708663)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 28959492
GRCz11 1 29763423
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTGTTAAAGAGGCCTCAACAAAAATACGCAGATACTACAGGAATAACTA[T/G]AAATATGGATCCGGTGCAAAAACCATTTGTAAGATTTTTACCAGTTGTTA
Associated Phenotype:
Not determined