Busch Lab

ZMP

B8A5G1_DANRE

Ensembl ID:
ENSDARG00000037122
Description:
Novel protein similar to vertebrate odz, odd Oz/ten-m homolog 2 (Drosophila) (ODZ2) [Source:UniProtK
Human Orthologue:
ODZ2
Human Description:
odz, odd Oz/ten-m homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:29943]
Mouse Orthologue:
Odz2
Mouse Description:
odd Oz/ten-m homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1345184]

Alleles

There are 19 alleles of this gene:

Allele Name Consequence Status Availability
sa31988 Essential Splice Site Available for shipment Available now
sa13488 Nonsense Available for shipment Available now
sa22492 Nonsense Available for shipment Available now
sa17807 Nonsense Available for shipment Available now
sa42403 Nonsense Mutation detected in F1 DNA Not yet available
sa22493 Essential Splice Site Available for shipment Available now
sa11224 Nonsense Available for shipment Available now
sa35702 Nonsense Mutation detected in F1 DNA Not yet available
sa1449 Nonsense F2 line generated Not yet available
sa22494 Nonsense Available for shipment Available now
sa18320 Nonsense Available for shipment Available now
sa22495 Essential Splice Site Available for shipment Available now
sa15917 Nonsense Available for shipment Available now
sa22496 Nonsense Available for shipment Available now
sa22497 Nonsense Available for shipment Available now
sa22498 Nonsense Available for shipment Available now
sa1714 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31988
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043058 Essential Splice Site 77 2694 1 28
Genomic Location (Zv9):
Chromosome 14 (position 30255023)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 28975759
GRCz11 14 29316236
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGGCTGACCTGGTGCACCATGAAGCAGACGAGTTCACCAGACAAGGAGG[T/C]AATGCAACAAAGTATACACATAATTATGGATACAGTACAGTATATACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13488
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043058 Nonsense 291 2694 4 28
Genomic Location (Zv9):
Chromosome 14 (position 30508991)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29299058
GRCz11 14 29639372
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGACAGTATATTCACCACCTCCACGGCTCCTACCCAGAAACACCTTCTCC[A/T]GAAGCGCCTTCAAGCTGAAGAAGCCGTCCAAGTACTGCAGCTGGAAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22492
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043058 Nonsense 305 2694 4 28
Genomic Location (Zv9):
Chromosome 14 (position 30509034)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29299101
GRCz11 14 29639415
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTCTCCAGAAGCGCCTTCAAGCTGAAGAAGCCGTCCAAGTACTGCAGCT[G/A]GAAATGTGCAGCCCTGTCGGCGATCGCTGCTGCCGCCCTGCTGGCCATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17807
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043058 Nonsense 368 2694 5 28
Genomic Location (Zv9):
Chromosome 14 (position 30551888)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29341945
GRCz11 14 29682259
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGCCGGGCTGCCCAGCAACAGTGACRTAGCAAYAWCGCCCTCTGGAGGC[A/T]GAGGTGAGCAGCACAGCCTGCAGTCCTGCACGCTTTTTACCATAAGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42403
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043058 Nonsense 493 2694 7 28
Genomic Location (Zv9):
Chromosome 14 (position 30562679)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29352736
GRCz11 14 29693050
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGATCCCGGCACATGGCATCTGGCTTTCTACAATGACGGCAAGGAGAAG[G/T]AATCTGTCTCCTTTAGCACTGCTGTTCTGGGTCAGTTGATGGTTAAACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22493
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043058 Essential Splice Site 537 2694 9 28
Genomic Location (Zv9):
Chromosome 14 (position 30570154)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29360211
GRCz11 14 29700525
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGCATCAAACCCTTATTCTCTCTCCTTGTTATATTTCTGTTTCTTTTAA[A/C]GCGGCATGTCCTGTCCTCTGCAGTGGAAATGGTCAGTACGACAAGGGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11224
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043058 Nonsense 686 2694 11 28
Genomic Location (Zv9):
Chromosome 14 (position 30582027)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29372084
GRCz11 14 29712398
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTTGCTCGGTTGACTGCGGTACACACGGCGTATGCATGGGCGGTTCTTG[C/A]CGCTGTGAGGAAGGCTGGACAGGCGCAGCTTGTGACCAGCGTGTGTGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35702
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043058 Nonsense 737 2694 12 28
Genomic Location (Zv9):
Chromosome 14 (position 30595327)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29385384
GRCz11 14 29725698
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAATCCATCTTTCTCTCTCTGGCTGTTGCAGATGGCTGTCCGAACAGATG[T/A]AATGGAAATGGACAGTGTCTTCTGGGTCAAAACAGCTGGCACTGTGAGTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7745
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043058 Nonsense 810 2694 13 28
Genomic Location (Zv9):
Chromosome 14 (position 30596548)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29386605
GRCz11 14 29726919
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAAGTCCCTGCCAGAATAGTCCACTTTGTAGAGGATCAAGGGATCCCTTA[C/T]AGGTCATCCAGCAGGGTCAGCATCCTGAGCAGAAAGTCCGTTCCTTCTAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28319
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043058 Nonsense 1036 2694 16 28
Genomic Location (Zv9):
Chromosome 14 (position 30599687)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29389744
GRCz11 14 29730058
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCAAAGTCCATCTTATGGTTGCTGTAGAGGGCCATCTCTTCCAGAAGTG[G/A]TTCCACGCTTCACCCAACCTCGCCTACACCTTCATCTGGGACAAGACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1449
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043058 Nonsense 1411 2694 22 28
Genomic Location (Zv9):
Chromosome 14 (position 30616168)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29406225
GRCz11 14 29746539
KASP Assay ID:
554-1375.1 (used for ordering genotyping assays)
KASP Sequence:
GCCCTGGAAAGTGCCACTGCTATCGGCATCTCCCATACAGGAGTRCTTTA[C/A]ATCGCAGAGACGGATGAGAAGAAGATCAACCGTGTGCGGCAAGTCAGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22494
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043058 Nonsense 1441 2694 22 28
Genomic Location (Zv9):
Chromosome 14 (position 30616256)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29406313
GRCz11 14 29746627
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCAAGTCAGCACCAATGGAGAGATGTCGCTTTTAGCTGGCGCTACATCA[G/T]AATGCGACTGTAAGAATGACGTCAACTGCAACTGTTTCGCAGGAGATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18320
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043058 Nonsense 1616 2694 22 28
Genomic Location (Zv9):
Chromosome 14 (position 30616782)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29406839
GRCz11 14 29747153
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTCAACCAGGAGATYKTTCTACTGGGRTACAATGGAAACACTGGCCTTT[T/A]GGCTACCAAGGCTGATGAGACAGGCTGGACAACTTTTTATGAGTAAGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22495
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043058 Essential Splice Site 1767 2694 24 28
Genomic Location (Zv9):
Chromosome 14 (position 30621690)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29411747
GRCz11 14 29752061
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAAGAGCTGTCCAAGGGCAAGGTCACTGTGTTCGGGAGGAAACTTCGGG[T/C]GGGCACTCCTTTTAGGATAATGATATCTCTCTACTCTTACACGTTATGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15917
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043058 Nonsense 1851 2694 25 28
Genomic Location (Zv9):
Chromosome 14 (position 30622025)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29412082
GRCz11 14 29752396
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAGTATGAGTGAAAGAACAGAGTTTGAWGCACAGGGTCGARTCCTCTCA[C/T]GATCTTTTGTTRATGGAAAAGTGTGGAGCTACARTTAYCTAGACAAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22496
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043058 Nonsense 2151 2694 26 28
Genomic Location (Zv9):
Chromosome 14 (position 30624457)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29414514
GRCz11 14 29754828
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATGGACAACTCAGTGGTGTCAAGGTCAATGACTGGTCTACTTGGCGCTA[C/A]AGCTATGACTTAAACGGCAACTTACACCTGCTTAACCCAGGCAACAGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22497
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043058 Nonsense 2169 2694 26 28
Genomic Location (Zv9):
Chromosome 14 (position 30624509)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29414566
GRCz11 14 29754880
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTATGACTTAAACGGCAACTTACACCTGCTTAACCCAGGCAACAGTGCC[C/T]GACTCATGCCCCTCCGCTATGACCTACGTGACCGTATCACACGCCTTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22498
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043058 Nonsense 2193 2694 26 28
Genomic Location (Zv9):
Chromosome 14 (position 30624581)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29414638
GRCz11 14 29754952
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCTACGTGACCGTATCACACGCCTTGGTGATGTCCAGTATCGTCTAGAT[G/T]AAGATGGCTACCTAAGTCAAAGAGGCAGCGATGTGTTTGACTACAACTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1714
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043058 Nonsense 2522 2694 28 28
Genomic Location (Zv9):
Chromosome 14 (position 30627621)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29417678
GRCz11 14 29757992
KASP Assay ID:
554-1660.1 (used for ordering genotyping assays)
KASP Sequence:
AAGGCCGTGTGGTCACWGGAGTCTCCAGCATGGCCAGCGATGACAGCAGG[A/T]AGGTGGTTCTGGTGTTAAATGGCGCAGTATATTTAGRCGGGACGCACTAC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461