Busch Lab

ZMP

slc7a2

Ensembl ID:
ENSDARG00000037097
ZFIN ID:
ZDB-GENE-041212-5
Description:
Low affinity cationic amino acid transporter 2 [Source:UniProtKB/Swiss-Prot;Acc:Q5PR34]
Human Orthologue:
SLC7A2
Human Description:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 [Source:HGNC Symbol;A
Mouse Orthologue:
Slc7a2
Mouse Description:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 Gene [Source:MGI Symb

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa22500 Nonsense Available for shipment Available now
sa15902 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22500
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045423 Nonsense 153 640 3 12
ENSDART00000053921 Nonsense 153 640 3 13
ENSDART00000126009 Nonsense 153 641 2 11
Genomic Location (Zv9):
Chromosome 14 (position 31256980)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 30047037
GRCz11 14 30387351
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGATGAGATTATAGGCGGTCACATTGAAAAATTCTGCAAAATGTACTTC[A/T]AAATGAGTTTGCCTGGCCTGGCGGAGTACCCTGATTTCTTTGCTGTTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15902
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045423 Nonsense 222 640 4 12
ENSDART00000053921 Nonsense 222 640 4 13
ENSDART00000126009 Nonsense 222 641 3 11
Genomic Location (Zv9):
Chromosome 14 (position 31255053)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 30045110
GRCz11 14 30385424
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCTGGATTTGTCAAAGGAGACTCTCTCAATTGGAACATATCAGAGGAAT[C/A]GCTCGTAAATTACACAGTTGTCAAAAGGTGGAAMAYATTTCTTGTTTCTC
Associated Phenotype:
Not determined