Busch Lab

ZMP

galca

Ensembl ID:
ENSDARG00000037064
ZFIN ID:
ZDB-GENE-040724-243
Description:
Galactocerebrosidase [Source:UniProtKB/Swiss-Prot;Acc:Q5SNX7]
Human Orthologue:
GALC
Human Description:
galactosylceramidase [Source:HGNC Symbol;Acc:4115]
Mouse Orthologue:
Galc
Mouse Description:
galactosylceramidase Gene [Source:MGI Symbol;Acc:MGI:95636]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa25131 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29301
Status:
No KASP design
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053870 Nonsense 47 660 2 17
Genomic Location (Zv9):
Chromosome 20 (position 4834669)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 4750036
GRCz11 20 4792949
KASP Assay ID:
554-6925.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTTGTTTGTTTGTTTGTTTGTTTGTTTGTTTGTTTTCAGGCCACTTCT[C/T]GACTTCTTGTCAATTATGAAGAACCCTATCGGAGTCAGATATTGGATTAC
Long Flanking Sequence:
TTATGATTTTGTAGTTTTTACGCTTGAAAAGCAGAAATAGAAAAGACATGGACGTTAAAAAAACGAACTGCAAACTAAGTATTTATGATTATACACCATTGCGTGATTGCGTTTCTTTTCTAATGACTGATTATCATGCGTCTCGCGTGTATATCAATATGAGCACATGACGCGGAAGTAATAGCTGCTGGTAATCATAAACATCCTCATGACAGACTTCAGCCGCAGTTCATTGAAACTCCAGTCGAATCATGCAAACGCACAATTTTCTGTGCATAATCTCCGTCATTCTCGGATGTTCGGCTCAGTTTTATGTTATAGATGATCGGATTGGTTTAGGGCGGGAGTTTGATGGAATAGGGGGCTTAAGTGGTGGAGGAGTAAGTCATGTTCACAAGTTTAATGTGTCTGTCAAAAGTTGGCCAGTTGTTGATTAACTCTTTGTTTGTTTGTTTGTTTGTTTGTTTGTTTGTTTGTTTGTTTGTTTTCAGGCCACTTCT[C/T]GACTTCTTGTCAATTATGAAGAACCCTATCGGAGTCAGATATTGGATTACTTATTCAAGGTATTTAGTCATTCGTTTTAGTAATTTTTTATTAATGATGTATTTTATAATAATCATACGTTATTATTAATGTGTTATATATGTGGGTTTGGTTTTATTTAGCCCAACTTTGGAGCTTCACTTCACATCCTCAAGGTAGAAATAGGAGGCGATGCTCAAACCACAGGTGAAGCAAAGTATTTTCTGTGTATTTTCCCTTCTGTTTTGCATATCTGACTGTCTATAGCTTTTTAGGTATATCAAATTATCCAAAAGACATTAAAATAAACAACCAAGTTTTTGATTTGAGTATAAATCAAGGATAAAACATAAAATATATCAGGGTTATGCAGTTGTTCTGAAGAGAATACCTAATTCAGAAAATTGTCTTGAAATTGAAAGCTTATTGGTTAGTTTTCTGTAACATTTTATTGTTATTTCATAGAAAGCAATAGTTTAACT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29300
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053870 Nonsense 152 660 5 17
Genomic Location (Zv9):
Chromosome 20 (position 4832107)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 4747474
GRCz11 20 4790387
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGATACGGAACCCAATGGCCTTACTTTTTTCCAAATGTTACAGCCAACTA[T/A]GTTATCACATGGGTCATGGGAGCAAAGCAGCATCATAACCTTGACATTGA
Long Flanking Sequence:
TAGGATAATCAGTCATTAGCTAAAATTGGAACAGCTGTGAACAATCATAAGCACGTGATCCTCTCGAAATTTGTTTATAAATAAACTTCACTTAAAACAAGACTATAGTTTCGCTTGTCTAGAAAATGCTTCCTGATTTAACAATTTTTAGATATTAGGACTAGAAACAAGACTAATCTAATGTTGCATGTCTTTTGTACAGATGGCACAGAACCCTCTCACATGCACAGTAAGGATGAGGGGAATTTTTTCCGTGGATACGAGTGGTGGCTTATGAAGGAAGCCAAGAAAAGAAATCCAAACATTAAGCTGATCGGTAATCCGTTTGTTCCAAGCTGCATTTTCCATTTTTATTATTAAGGACAAAAGTAATATAGAACTCAAAGAAATTTGAGTTGATTTAAATGATCTGATTATGTAGGTCTTCCCTGGGCATTTCCCGGATGGGTTGGATACGGAACCCAATGGCCTTACTTTTTTCCAAATGTTACAGCCAACTA[T/A]GTTATCACATGGGTCATGGGAGCAAAGCAGCATCATAACCTTGACATTGATTATATCGGGGTATGTAAGCACTAGCTGATAATTACTCGCTCCAAATTAATCGTATATGTCTATTACTTAATTATGTTATGGCTATTACTGATGTCGTTTTCTTTAATAACATTCTTTATTTAACTTCTATTTTTATTTGATTTGTTTGATGTATTTATTTTTAGATTTGGAATGAGAAAGCATTTGATCCGACATACATTAAGGTAAACTGGATATCCTTTTTAGTTTAAAACATAACTAACTGTATTGTCAGTAACCGCATCAACATTTCACCTAGGTGCTGAGAGATGCTTTGGACAGAGCTGGCTTCACGAATATCGGCATCATTGCTGCAGATGGAGACTGGTCTATTGCGTCTGCCATGCTGGATGATCCATATCTGAATGATGCTGTCGAGGTCATAGGGTGAGCAATAGCAGTGTAATATGTTCAGTGATTCAAGGAGAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25131
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053870 Nonsense 242 660 8 17
Genomic Location (Zv9):
Chromosome 20 (position 4828616)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 4743983
GRCz11 20 4786896
KASP Assay ID:
554-7346.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTTTACAGTGTCCACTACCCAGGAACCAACACAGTAAAGGAAGCTCTGT[T/A]GACGGAGAGAAAGCTCTGGTCATCTGAAGACTACAGCACCTACAATGACG
Long Flanking Sequence:
ACAACAATCCACATCCATACTGGCGTTTAGCATTTCTGAGCAGCCCTCCTTCCTCACTACCGCTGAAAACGCACATCACGTGACCACACACACACGCATTCACACACACAGGCACACACACACATACACTGTCATGCACTCGAGACAGTGGGTCCAGGCAGTCAGCGGGTCAGTAGACTGGTTCAATCTTTCATTTTCACACTAGTACTTAGTCATTTTAGCGAACACCTCAGATACTGTTGGCTGGTTCCTGTTGGTTGTGTACCTTTTTTACCGACGCCATTATAACGACACCGATCACTGCCTATTCACGAGTCCCATATCTTATATCTAATATCCCATCACTTATTTACAGTTGGGTGTTTGGTACATTATGCCCTATCTACCCATATAATCAACCTACTAGCTGATCTAATAAGCATAAAACTAACCTGTAATCACGGTTTACATTCTTTACAGTGTCCACTACCCAGGAACCAACACAGTAAAGGAAGCTCTGT[T/A]GACGGAGAGAAAGCTCTGGTCATCTGAAGACTACAGCACCTACAATGACGACATCGGTGCCGGATGTTGGGCTCGCATTCTCAACCAGAACTACGTGAATGGCAAAATGACCTCGTGAGCTGATTTCACACACCCTTCTCTCTTTTCTTTATTGTATATGTGTCTTTATGCTGACCGACTGCTTTCTTTTAGGACTATATCCTGGAATGTAATAGCAAGTTATTATGAGAATCTGTCATTTGGTAGAGATGGTCTGATGACGGCAGAGGAGCCCTGGAGTGGACATTATATAGTGGAATCTCCAATATGGATGACTGGTAATGTATTTTTAATAGTCGTGAATCAGCACACATCATTTGTGTAATTTGTCACTTTCAAAATGGCAGATTTTTGGGTCAACATTTTTAAGCATTAATTCAATAATAATAATAATAATATTGACAAACAATTAAATTCTACCAATGTAAATCATACAAGTTTTCTCAAATTACTTTTCCATA
Associated Phenotype:
Not determined