Busch Lab

ZMP

rad51l1

Ensembl ID:
ENSDARG00000037046
ZFIN ID:
ZDB-GENE-040426-2750
Description:
DNA repair protein RAD51 homolog 2 [Source:RefSeq peptide;Acc:NP_998577]
Human Orthologue:
RAD51L1
Human Description:
RAD51-like 1 (S. cerevisiae) [Source:HGNC Symbol;Acc:9822]
Mouse Orthologue:
Rad51l1
Mouse Description:
RAD51-like 1 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1099436]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa23643 Essential Splice Site Available for shipment Available now
sa43390 Nonsense Mutation detected in F1 DNA Not yet available
sa31040 Nonsense Mutation detected in F1 DNA Not yet available
sa43391 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa23643
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053847 Essential Splice Site 66 373 2 10
ENSDART00000138797 None None 101 None 3
Genomic Location (Zv9):
Chromosome 20 (position 9653559)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9487688
GRCz11 20 9475342
KASP Assay ID:
2261-4004.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAATCTCCAGCGTCTGGTCAGTAAAGCCTGTGCTCCGGCTGTCATCACTG[T/A]AAGTTATTACCGCATTAAAAGTGTAGTACCCCAAAAAAAGAAAATGTACT
Long Flanking Sequence:
GTCACACTCATAAACTACATTACCCACAACCAATATGCACTACATTTTCTCGTCAGTTTCCGGGCGCGCTTCACACTTTCATAACTTACCCTGTAACAGGTTTCCATTGAAAAACTTCACATTAAAGCTGTCTACATAATGTGTACAGCCGTTACTAAAGGGTGTCATGTTTTATAGTTAAAATACAATAGTATAGCGCTTTTTAATCGCTTTAATGAGTAGTAAGAAGTTGCGGAGATCCGGAGTCTCAGCTGATCTGTGCGAGAGACTCAAGCGGCATCAGCTGGAAACCTGCCAGGTAAAACAGTCTGACCACCTCTTGAATGTTTCTTCATAACGAGAGTAGACTTCTTTTAATGTGTGTATGTGTGTGTGTGACCTGTAGGATGTCCTGTCGGTCACCCAGGTGGAGCTTTCGCGTCTGGCTGGACTTAGTTACCCAGCGGCTCTGAATCTCCAGCGTCTGGTCAGTAAAGCCTGTGCTCCGGCTGTCATCACTG[T/A]AAGTTATTACCGCATTAAAAGTGTAGTACCCCAAAAAAAGAAAATGTACTCAATATTTACTCTCCCTCAATTGGTTATAAACATTTATGAGTTTCTTTCTTTTCTTTTGAATGCAAAAGAAGATATTTTGAAGAAGGCTGTAAACCTGCAACCAATGAAATATTTAGTAGCAAAAACCAATGCTGTGGATGGAAGTCGATGGTTACAGGTTTTCAGCTTTTTTCTAAATATCTTCTCTTGTGTTCAACAGAAGAAAGAAACCCAAACAGGTTTGGAACAAGTCAAGGGACAGTAAATGATAACAGAATTTTTAATTTCAGTGAACCATGCCTTTAAGTCGTGTTCATTTGACATCATGTTCAGTCTTTCATCAGTAGTTGATTCTCTTTTTGATGACAGGCCTTGGATTTGTGGAAGAGGAAGGAAGAGCTGTGTTTCTCAACATCGCTTCCTGCTCTGGACAGATTACTGCATGGAGGACTGCCGCGGGGTGCTCTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43390
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053847 Nonsense 199 373 6 10
ENSDART00000138797 None None 101 None 3
Genomic Location (Zv9):
Chromosome 20 (position 9663587)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9498205
GRCz11 20 9485353
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCGGATGTCACCCAGGCTTGAGCGTCTGGAGGAGGACATCATTGCTTGT[C/T]GAGCGGGGCTGGTTATCTTGGATTCTGTGGCCTCTGTTGTGCGGAAGGAG
Long Flanking Sequence:
TGAGCAGGGCTAGACGGAATCTGCTGAAGTTTTTTGTTATTTCTGCAGAGAATTTTGGTAAAAATCTGCGGATTTCTGTGGAATTATTTTGGGAGTATCCAGCAGAGTATCATAACTAAAACCTTGATATATTAAATAAAAAGTAATAAATTACTGAATAAAAACTTAATAAACTCAGATTTAAACATTTATTCAAGTAAATAAACAGAATTTATAATGAGTTAAAAATCTGCAGAAATCTGTGGAATTCTGCAGAAAATCTGTGGAAAATCTGCGGAATTCTGCACGCGCAGATTCCGTGTGGGCCTAGCAATGAGTAAAAACTTTAAATATAACATTGCACAGTATTTGCAAAACAATTATTGCATAAATGAGTCTGAGATTATGATCATCTGAAATAGTACAGTAGGTCAGGCTGTGTCGTTTAAGCTCATGAAAACATTAATGCTGCTCGGATGTCACCCAGGCTTGAGCGTCTGGAGGAGGACATCATTGCTTGT[C/T]GAGCGGGGCTGGTTATCTTGGATTCTGTGGCCTCTGTTGTGCGGAAGGAGTTTGACACGTCACTTCCCGGAAATCTGACACACAGAAGTAACTTCCTCGGCCAGGAAGCAGCTGTACTGAAGTACCTCTCTCAGGAGTTCTGCATTCCGGTGAGAGACTAGCACATGGATGTAGCACAGATCATACACTTGTAGTACATTCCACAAGGTGGCGCTACCCATTTACTTTTGTGCATGTAAGTGCTGCTTTTTTCAGTCACATTCAAGTTCAAGGGAAACAATAGAGTTTAAAACATGCAAAAGAGTTAATAACAACGCATTGTTTGCTTTTCTGTTGGTTTGACTGGCTTCTAGTTCTCTTACTTGTTAGTCACTTTGAATAAAAGTGTCTGTCAATTGAATAAATGCAAACAAGACATAAAATGAGTCGGATTAGGGCAACTGCGTACATTTTGAATTTTATATATATATTTTTTCTTCTTTTTCTTCCTATTTTTTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31040
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053847 Nonsense 268 373 7 10
ENSDART00000138797 None None 101 None 3
ENSDART00000053847 Nonsense 268 373 7 10
ENSDART00000138797 None None 101 None 3
Genomic Location (Zv9):
Chromosome 20 (position 9678270)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9510998
GRCz11 20 9498238
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTAACCAGATCACCACACATGTGGGCGAGAAGCTTCACTGTCCTCAGT[G/A]GAATCAGACAGATGGTAAGAACAGCCTCCCAATCGTCTAAACTTGAGTTT
Long Flanking Sequence:
CAGAATTATCCAAACTCTTTGAATTTTTCAAGTGAGATGCTAACGGTCTAATCCGATTTAATAATTTATGCTAAGCTAAGCTAAACTGCTTAGCAAAAAAAAATAAAAAAATAAAAAAAAACCTACACAAGATTTTTTTTTCCACCAGAATATTAGCCCCTAAAACTCATTGTAGCTTTGATAATTGTACAAAAAGTTTCTGGAGGACCAAATCAGCATATTTTGTTTTTCCATTTTAAGCTCACCACATGTCTTCACTCTATGATGTAATTAGTATGATTATGTAATGACTGATGTCAACAGTTGTGAAGAGATTGTGATGATGAATTCAGTGTCCGCTGAACTTGCTTAGAGACGGCAGACTGTTTATTCTCATCTTTCATGTGAACCAGTCAAGCTGGACTGAACTCTACTACAGATGTTTTCCTTCTATCTCCCTCAGGTGGTTTTAACTAACCAGATCACCACACATGTGGGCGAGAAGCTTCACTGTCCTCAGT[G/A]GAATCAGACAGATGGTAAGAACAGCCTCCCAATCGTCTAAACTTGAGTTTTAGTACCATGTTTTTGTGTAAAAGCACCGTGTGACGGGATTAGGTGGTGCAAACCTAGACCATAAATTCCCATCAAGAGGCTCTTTTGTTTCATGACGAGCCGTTCTCTGATTTCAACATCGTTCTCAACCATTTTGCGATGGTATGTGGGACAAATAAGCATCAGATATGGCCTTCCACACAAGCAGCTGCTGTAGTCAGTTGGGAACTATGTACAGATGAAGTCAAAAGTTCACATACGCCTCACAGAATTTGCATTATTATGCTAAAATAAGAGGTTCTTTTAAACTTTGCTCTCACCGAAAGGCTTTTACATATAGTTCACAATATAAAATAATAGTAGACCTAACATACAGACAGCAAAAATTACAAATTTTTCCTCTTGCCAAAAGGTAAAACAAGCAACAGCCAAGTATGCATGATTATATGGTGTCATGGCCTTGCAATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43391
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053847 Nonsense 268 373 7 10
ENSDART00000138797 None None 101 None 3
ENSDART00000053847 Nonsense 268 373 7 10
ENSDART00000138797 None None 101 None 3
Genomic Location (Zv9):
Chromosome 20 (position 9678270)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9510998
GRCz11 20 9498238
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTAACCAGATCACCACACATGTGGGCGAGAAGCTTCACTGTCCTCAGT[G/A]GAATCAGACAGATGGTAAGAACAGCCTCCCAATCGTCTAAACTTGAGTTT
Long Flanking Sequence:
CAGAATTATCCAAACTCTTTGAATTTTTCAAGTGAGATGCTAACGGTCTAATCCGATTTAATAATTTATGCTAAGCTAAGCTAAACTGCTTAGCAAAAAAAAATAAAAAAATAAAAAAAAACCTACACAAGATTTTTTTTTCCACCAGAATATTAGCCCCTAAAACTCATTGTAGCTTTGATAATTGTACAAAAAGTTTCTGGAGGACCAAATCAGCATATTTTGTTTTTCCATTTTAAGCTCACCACATGTCTTCACTCTATGATGTAATTAGTATGATTATGTAATGACTGATGTCAACAGTTGTGAAGAGATTGTGATGATGAATTCAGTGTCCGCTGAACTTGCTTAGAGACGGCAGACTGTTTATTCTCATCTTTCATGTGAACCAGTCAAGCTGGACTGAACTCTACTACAGATGTTTTCCTTCTATCTCCCTCAGGTGGTTTTAACTAACCAGATCACCACACATGTGGGCGAGAAGCTTCACTGTCCTCAGT[G/A]GAATCAGACAGATGGTAAGAACAGCCTCCCAATCGTCTAAACTTGAGTTTTAGTACCATGTTTTTGTGTAAAAGCACCGTGTGACGGGATTAGGTGGTGCAAACCTAGACCATAAATTCCCATCAAGAGGCTCTTTTGTTTCATGACGAGCCGTTCTCTGATTTCAACATCGTTCTCAACCATTTTGCGATGGTATGTGGGACAAATAAGCATCAGATATGGCCTTCCACACAAGCAGCTGCTGTAGTCAGTTGGGAACTATGTACAGATGAAGTCAAAAGTTCACATACGCCTCACAGAATTTGCATTATTATGCTAAAATAAGAGGTTCTTTTAAACTTTGCTCTCACCGAAAGGCTTTTACATATAGTTCACAATATAAAATAATAGTAGACCTAACATACAGACAGCAAAAATTACAAATTTTTCCTCTTGCCAAAAGGTAAAACAAGCAACAGCCAAGTATGCATGATTATATGGTGTCATGGCCTTGCAATCAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29314
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053847 Essential Splice Site 309 373 8 10
ENSDART00000138797 Essential Splice Site 37 101 1 3
Genomic Location (Zv9):
Chromosome 20 (position 9700332)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9532261
GRCz11 20 9519501
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTTAACACACGTCTCATCGTTCAGTATGAGGACTCAGAAAGAAGACAG[G/A]TAATCGCCAACACTGTGCAAAATTATCTTTAAATATATAAAGAGCAAACT
Long Flanking Sequence:
GGAGACGGGAGGGGGGACAAGCGTGCTTTGGCCTGGTTCGAGGCAACTGTACCTAGTGTGAGTACGGCCTAAGATGAAGGGGCCTTGAGGGTCGACAAATCCCATCATTACCAGCAGAGTTCAACAAAAATAGCAGCAATAATTGAGTAATGATGCTTTTGGGAAACACAACCCTGAACCTAATCAAGGTCTATAGATTCACTAGAAAGCTCAAGGCAAGTGTTGGCCCTCAGGGAGCAGAACTGGACACCTGGTTTAAATTATTTTGCAGGTTTTTAATAAAACAACATTTTTATTTAATCACCAAAGCCACATTTTTTACTCTATTTTGGCACTTGACAAATATTACAATAAAGGTCTGACTGTATGAAATCTGTTTGGGGTTTTCAGCATCTTTCGAGGAGGATTCTGGGTTTGTGACAGCGGCGCTGGGGAACACATGGAGTCACAGTGTTAACACACGTCTCATCGTTCAGTATGAGGACTCAGAAAGAAGACAG[G/A]TAATCGCCAACACTGTGCAAAATTATCTTTAAATATATAAAGAGCAAACTTCAATTGCCAAAACAAACCAAGCAACTCTAGTACTCTTTAAACGTTTACAGTAAACCAGTATCATCTTACTCTGTAAACATTGCTCGAGTATAGAGCTTAGGTATTGCTGACATCTTGCACTACAATAACTTTTGTTAGGTGTGGTCACAACAATATATGCATCACAATGGGATTGAAAGGTCATTTACTGTAAGTTGCTGCCAGACTGGCTGACCTAAGTATAAGATTTACAGAGTAAAATAGAAATGTATAGTAAGCATCAGTTCTGGAAAATGCCTTTTTGTTCAGAGCTACAGTAGTGTTCAGAGAAGAATCAACAGACTGGTTCAGCTGACAGTCACTCAAAATCACTTGGTACAATCCTCTGAACACACAACAGACCAAACCTTGAAGCAGATGAGCTACAACAGCAGAAGAAGAAAAAGAAGAAAACGCTGTCAATTCTGTCA
Associated Phenotype:
Not determined