Busch Lab

ZMP

ddhd1

Ensembl ID:
ENSDARG00000037042
ZFIN ID:
ZDB-GENE-040724-18
Description:
phospholipase DDHD1 [Source:RefSeq peptide;Acc:NP_001025417]
Human Orthologue:
DDHD1
Human Description:
DDHD domain containing 1 [Source:HGNC Symbol;Acc:19714]
Mouse Orthologue:
Ddhd1
Mouse Description:
DDHD domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2150302]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa134 Nonsense Available for shipment Available now
sa43392 Nonsense Mutation detected in F1 DNA Not yet available
sa8584 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa12215 Nonsense Available for shipment Available now
sa6616 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa134
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053841 Nonsense 294 859 2 13
ENSDART00000145439 Nonsense 294 644 2 9
Genomic Location (Zv9):
Chromosome 20 (position 9971762)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9803691
GRCz11 20 9790931
KASP Assay ID:
554-0085.1 (used for ordering genotyping assays)
KASP Sequence:
AGGACAGTGACCTTATTGAACTGGAGCACTTAGCCTGTTTCCGGGGCCAG[C/T]AGATGAAGGACACCTTTGACACGGAAGCAGTGGCCACCACAGTGGACAGC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa43392
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053841 Nonsense 354 859 3 13
ENSDART00000145439 Nonsense 354 644 3 9
Genomic Location (Zv9):
Chromosome 20 (position 9972286)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9804215
GRCz11 20 9791455
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCCACCACCTCTAAGATTGCACGGACGGTCACTCAGAAGCTGGGATTCT[C/A]AAAAGGTTTGTTAAACATTTGATTAGTAAATACTCTCACGTGTTGCTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8584
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053841 Essential Splice Site 356 859 3 13
ENSDART00000145439 Essential Splice Site 356 644 3 9
Genomic Location (Zv9):
Chromosome 20 (position 9972293)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9804222
GRCz11 20 9791462
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACCTCTAAGATTGCACGGACGGTCACTCAGAAGCTGGGATTCTCRAAAGG[T/C]TTGTTAAACATTTGATTAGTAAATRCTYTCACGTGTTGCTAATTAATAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12215
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053841 Nonsense 666 859 11 13
ENSDART00000145439 None None 644 None 9
Genomic Location (Zv9):
Chromosome 20 (position 9985696)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9817625
GRCz11 20 9804865
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ANTTTTTTATCTATTTTTTTRTAGGTACAACACCACCAGCCCCACACCGTA[T/A]GACCAGATCCGTCCCACTCTACTGAATCCATCAAAGGAAAATGCGTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6616
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053841 Essential Splice Site 800 859 13 13
ENSDART00000145439 None None 644 None 9
Genomic Location (Zv9):
Chromosome 20 (position 10004043)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9835972
GRCz11 20 9823212
KASP Assay ID:
554-4491.1 (used for ordering genotyping assays)
KASP Sequence:
GAMTATATTATCTCCAGGCCTCTATGTAATCTTTGTTGTTCCTGTGTTGC[A/G]GTGGAGCTGGAGAAGCGCATTGACTTTGAGCTGCGGGAGGGTCTGGTGGA
Associated Phenotype:
Not determined