Busch Lab

ZMP

erbb3b

Ensembl ID:
ENSDARG00000036993
ZFIN ID:
ZDB-GENE-050107-1
Description:
hypothetical protein LOC100149258 [Source:RefSeq peptide;Acc:NP_001122291]
Human Orthologue:
ERBB3
Human Description:
v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) [Source:HGNC Symbol;Acc:3431]
Mouse Orthologue:
Erbb3
Mouse Description:
v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) Gene [Source:MGI Symbol;Acc:MGI:95

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa14974 Nonsense Available for shipment Available now
sa29934 Nonsense Mutation detected in F1 DNA Not yet available
sa5978 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa18520 Nonsense Available for shipment Available now
sa8650 Nonsense Mutation detected in F1 DNA Not yet available
sa37713 Nonsense Available for shipment Available now
sa37714 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa14974
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049893 Nonsense 85 1430 3 28
ENSDART00000128510 Nonsense 85 1429 3 29
ENSDART00000138974 Nonsense 85 1426 3 28
Genomic Location (Zv9):
Chromosome 23 (position 25538587)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25324707
GRCz11 23 25251248
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGATRACATGCTTGACNTTTCTTCTAGAGTATCCGAGAGGTCACCGGCTA[C/A]ATCCTCWTTGCGATGAACCAGTTTCGCAAGTTACCTTTGAATCAGCTCMG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29933
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049893 Nonsense 154 1430 4 28
ENSDART00000128510 Nonsense 154 1429 4 29
ENSDART00000138974 Nonsense 154 1426 4 28
Genomic Location (Zv9):
Chromosome 23 (position 25543163)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25329283
GRCz11 23 25255824
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGATCTTGGAAGGTGGAGTACAGATTGTCCACAACAGGAACCTCAGCTA[T/A]GCTCCATTGATCAACTGGCAGGACATTGTCAGAGACGGTGACGCTCGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29934
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049893 Nonsense 264 1430 7 28
ENSDART00000128510 Nonsense 264 1429 7 29
ENSDART00000138974 Nonsense 264 1426 7 28
Genomic Location (Zv9):
Chromosome 23 (position 25545506)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25331626
GRCz11 23 25258167
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTCTGGCTCCTGCGTCCCTCACTGCCCTTGGCCTGTGGTCTACAACCAA[C/T]AGACCTTTCAGGTGGAGCCCAATGCTGATGCCATGTATCAGTTCGGTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5978
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049893 Essential Splice Site 538 1430 13 28
ENSDART00000128510 Essential Splice Site 537 1429 14 29
ENSDART00000138974 Essential Splice Site 534 1426 13 28
Genomic Location (Zv9):
Chromosome 23 (position 25558088)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25344208
GRCz11 23 25270749
KASP Assay ID:
554-3792.1 (used for ordering genotyping assays)
KASP Sequence:
AACTACAGTCGGCTCGGCACCTGTGTGTCTCACTGTAACCTCTACTMCGG[G/T]TCAGTGTTAGTTAGTTATTTTTTTATAGTTATTAAATGTTGGGTCGGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18520
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049893 Nonsense 840 1430 21 28
ENSDART00000128510 Nonsense 839 1429 22 29
ENSDART00000138974 Nonsense 836 1426 21 28
ENSDART00000049893 Nonsense 840 1430 21 28
ENSDART00000128510 Nonsense 839 1429 22 29
ENSDART00000138974 Nonsense 836 1426 21 28
Genomic Location (Zv9):
Chromosome 23 (position 25565609)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25351729
GRCz11 23 25278270
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCATGTATTATCTGGAGGAGCACTGCATGGCCCATAGGAACCTGGCTGCA[C/T]GAAACATACTGCTCAAGAGTGACTACATAGTACAGATCTCGGACTTTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8650
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049893 Nonsense 840 1430 21 28
ENSDART00000128510 Nonsense 839 1429 22 29
ENSDART00000138974 Nonsense 836 1426 21 28
ENSDART00000049893 Nonsense 840 1430 21 28
ENSDART00000128510 Nonsense 839 1429 22 29
ENSDART00000138974 Nonsense 836 1426 21 28
Genomic Location (Zv9):
Chromosome 23 (position 25565609)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25351729
GRCz11 23 25278270
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCATGTATTATCTGGAGGAGCACTGCATGGCCCATAGGAACCTGGCTGCA[C/T]GAAACATACTGCTCAAGAGTGACTACATAGTACAGATCTCGGACTTTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37713
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049893 Nonsense 1210 1430 28 28
ENSDART00000128510 Nonsense 1209 1429 29 29
ENSDART00000138974 Nonsense 1206 1426 28 28
Genomic Location (Zv9):
Chromosome 23 (position 25574286)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25360406
GRCz11 23 25286947
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACCATTTAAAACCAGCATCCCTTGTTTCTGCACACATATGTAGCAGTT[T/A]ACCTCAGAAAAAAGAAATGGACTCAGCACAAACCCAAGATGAAATTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37714
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049893 Nonsense 1312 1430 28 28
ENSDART00000128510 Nonsense 1311 1429 29 29
ENSDART00000138974 Nonsense 1308 1426 28 28
Genomic Location (Zv9):
Chromosome 23 (position 25574591)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25360711
GRCz11 23 25287252
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGCGATGGTCGAATATGAATACATGGACATACGTACAGATGAACACCAA[C/T]AAAATGTAGCTGGCAAACGTACAACAAACGGTCCAAATGAGGTGGAGAGG
Associated Phenotype:
Not determined