Busch Lab

ZMP

dctd

Ensembl ID:
ENSDARG00000036990
ZFIN ID:
ZDB-GENE-050417-116
Description:
deoxycytidylate deaminase [Source:RefSeq peptide;Acc:NP_001017639]
Human Orthologue:
DCTD
Human Description:
dCMP deaminase [Source:HGNC Symbol;Acc:2710]
Mouse Orthologue:
Dctd
Mouse Description:
dCMP deaminase Gene [Source:MGI Symbol;Acc:MGI:2444529]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4858
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053763 Essential Splice Site 97 201 3 6
Genomic Location (Zv9):
Chromosome 1 (position 40211474)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39130873
GRCz11 1 39848946
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCCTGGTCTCGCAGCGCAGATAACAAGCTGGACACCAAATACCCCTATGG[T/G]GAGTTCTGTGCTTGAACWGGCACAGTCAATTACCCATAATTATAAGACAC
Long Flanking Sequence:
TTGGCATTATTTTCCAGCAGGATCAGAAATAAAATTGATATATATTTTTTATATCCTCATATTTTGGCCAAAGTACTTCCGCCATGTATAATGCTATCAAAAAGGGCTCCGAAAATCCCCCTGGATTCCTCACACCCAGCCCATGCTCTCTTTGAACTTTTGCCCTCTGGCCGGTGTTAAAAATCACCACCAGAACCACCTTTAAATACTACACATTGATGTTTATTGATTTTTTTTTCTCCCTTTTGTTTTTATTACTGTTGTTTATTATTTGTGTTCTTATTGTCTGAACTGTGTACTTTCTGAACGTCCTTTGCTGGAAGCTGTTATTGGAAAATAACATTTCCTTCTATTTAATTTCAGGTTGGTGCCTGTATCGTGAATCAAGAAAACAAGATAGTGGGTATTGGCTACAATGGCATGCCTAATGGTTGTGATGATGACCTGCTACCCTGGTCTCGCAGCGCAGATAACAAGCTGGACACCAAATACCCCTATGG[T/G]GAGTTCTGTGCTTGAACTGGCACAGTCAATTACCCATAATTATAAGACACTCTGCCAAACACACGCTCACACAGACTGGTCAGAATGCACGGCAACTTTAAACACTTGCAGAAGAGGCTTTTTAGATTTCAGACTCTGTCGACGCAGCACATGGTGTCTGTTAACGCAGTGCGGAGATGTGTATGCTCTTTTGAGCACATGGTGGCATTAGTTTTCACCTGCGTGAGGCTGATGGAGGAGATAAAGGTGGAGCTGCTGAGTGAGGGAATGGCCAAGGTCACTTTGTGGCAGCTATTAGCATGAAAAATGGAAATGAGCTGGAGCTGGCGTTCCTGAAGGCGGCACATGCCAACTGTGGACTTTGAATGGGCCATACTGCCAAAGGGAAGGTGTGATCAATCAGTCTGGTGCTCGGCTGATCTTCTGAACTGTTTGTCAGTCACACTTTTCACTCTGGTTTATGTCAGTGAAGAGGCTTGTGTAGATTGTGTTTGTTTTTG
Associated Phenotype:
Not determined