Busch Lab

ZMP

smox

Ensembl ID:
ENSDARG00000036967
ZFIN ID:
ZDB-GENE-031201-3
Description:
spermine oxidase (smox), mRNA [Source:RefSeq DNA;Acc:NM_201502]
Human Orthologue:
SMOX
Human Description:
spermine oxidase [Source:HGNC Symbol;Acc:15862]
Mouse Orthologue:
Smox
Mouse Description:
spermine oxidase Gene [Source:MGI Symbol;Acc:MGI:2445356]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1313
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053685 Nonsense 2 539 2 7

The following transcripts of ENSDARG00000036967 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 42236843)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 41153159
GRCz11 1 41854323
KASP Assay ID:
554-1228.1 (used for ordering genotyping assays)
KASP Sequence:
CCTTGTTTCACCCTCTCTAGATTCCCTAGAAGAAGAGCTCGGACGGCATG[C/T]AAAGTTGTGAAATATCTTCAGACAGCACTGATGATCCTCTTAGTAGTGCC
Associated Phenotype:
Not determined