Busch Lab

ZMP

si:dkey-202m22.6

Ensembl ID:
ENSDARG00000036952
ZFIN IDs:
ZDB-GENE-091117-2, ZDB-GENE-091214-2
Description:
XK-related protein 7 [Source:RefSeq peptide;Acc:NP_001012252]
Human Orthologue:
XKR7
Human Description:
XK, Kell blood group complex subunit-related family, member 7 [Source:HGNC Symbol;Acc:23062]
Mouse Orthologue:
Xkr7
Mouse Description:
X Kell blood group precursor related family member 7 homolog Gene [Source:MGI Symbol;Acc:MGI:3526711

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa37748 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa37749 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37748
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053661 Essential Splice Site 240 560 2 3
Genomic Location (Zv9):
Chromosome 23 (position 31117095)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 30951985
GRCz11 23 30878516
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGCAGCTCAGCATTATGGTCCAGACCGGCCAGATTCTCCCTTTACAGGG[T/C]AAGTGTTGACAGCTATGATTAAAACCCACTCTCTACAAGTATGCTAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37749
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053661 Nonsense 349 560 3 3
Genomic Location (Zv9):
Chromosome 23 (position 31128569)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 30963459
GRCz11 23 30889990
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGAGATCATCTACAACATGATGGTGGGCATTGTGTATATATTCTGCTG[G/A]TTCAGCGTTCGTGAGGGTCCCACGCGGGGCCGTCTTCTGCTGTACAGCCT
Associated Phenotype:
Not determined