Busch Lab

ZMP

zgc:101853

Ensembl ID:
ENSDARG00000036894
ZFIN IDs:
ZDB-GENE-041212-13, ZDB-GENE-041212-13
Description:
hypothetical protein LOC494049 [Source:RefSeq peptide;Acc:NP_001008592]
Human Orthologue:
AIMP1
Human Description:
aminoacyl tRNA synthetase complex-interacting multifunctional protein 1 [Source:HGNC Symbol;Acc:1064
Mouse Orthologue:
Aimp1
Mouse Description:
aminoacyl tRNA synthetase complex-interacting multifunctional protein 1 Gene [Source:MGI Symbol;Acc:

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa30008 Nonsense Mutation detected in F1 DNA Not yet available
sa37799 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa30008
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053569 Nonsense 33 282 3 7
ENSDART00000129872 Nonsense 33 282 4 8
Genomic Location (Zv9):
Chromosome 23 (position 44869210)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 45643738
GRCz11 23 45405010
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTGCAGGCGTCAGTGAGGGAGGAGAAGAAACTGCTGGTAGAAAACGCC[A/T]AACTGAAGAAAGACATCGACGACCTGAAGAACCTGCTGCAGGACACACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37799
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053569 Essential Splice Site 54 282 3 7
ENSDART00000129872 Essential Splice Site 54 282 4 8
Genomic Location (Zv9):
Chromosome 23 (position 44869275)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 45643673
GRCz11 23 45404945
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCGACGACCTGAAGAACCTGCTGCAGGACACACAGAAGAGGAAAGCAGG[T/C]ACTACACACACACACACACACACACACACACACACACACACACACACACA
Associated Phenotype:
Not determined