Busch Lab

ZMP

slc2a12

Ensembl ID:
ENSDARG00000036865
ZFIN ID:
ZDB-GENE-040426-1513
Description:
Solute carrier family 2, facilitated glucose transporter member 12 [Source:UniProtKB/Swiss-Prot;Acc:
Human Orthologue:
SLC2A12
Human Description:
solute carrier family 2 (facilitated glucose transporter), member 12 [Source:HGNC Symbol;Acc:18067]
Mouse Orthologue:
Slc2a12
Mouse Description:
solute carrier family 2 (facilitated glucose transporter), member 12 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa24373 Nonsense Available for shipment Available now
sa37756 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa12204 Essential Splice Site Available for shipment Available now
sa12272 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29969
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053531 Nonsense 61 610 3 6
ENSDART00000143335 Nonsense 61 241 3 3
Genomic Location (Zv9):
Chromosome 23 (position 31859403)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31694293
GRCz11 23 31620824
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTGTGCTCTGTGTCTGTGGCCTGCCTGAGTGGCTTGCTGATGGGATAC[G/T]AGATGAGTCTGATATCTGGAGCTTTGCTTCAACTCAGGGACGTTTTGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24373
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053531 Nonsense 456 610 3 6
ENSDART00000143335 None None 241 None 3
Genomic Location (Zv9):
Chromosome 23 (position 31858218)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31693108
GRCz11 23 31619639
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACCTATAATCATAGGACTGCTTTAATGGAAACCGCTGAGCTTTCGAAG[A/T]AAGACAGTGCAAAGATTGCGCTTCAGTCTCTTCACGAAGTGTCGCCTTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37756
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053531 Essential Splice Site 494 610 3 6
ENSDART00000143335 None None 241 None 3
Genomic Location (Zv9):
Chromosome 23 (position 31858100)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31692990
GRCz11 23 31619521
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTCAGCCTGCTGGTGTATGTAGCTGGATTCTCCATCAGCTTGGGACCAA[G/A]TAAGATTCAGACTCAAACAAATGATATCTGTTTATATTACAAATTAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12204
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053531 Essential Splice Site 580 610 5 6
ENSDART00000143335 None None 241 None 3
ENSDART00000053531 Essential Splice Site 580 610 5 6
ENSDART00000143335 None None 241 None 3
Genomic Location (Zv9):
Chromosome 23 (position 31852204)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31687094
GRCz11 23 31613625
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGACCAAAGGCCGATCATTGGAACAGATCTCAAAGGAACTTGCAATGAA[G/A]TGAGTGGACATAAACACACACATTGGTTTTGGTGGTKTATAAGGACTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12272
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053531 Essential Splice Site 580 610 5 6
ENSDART00000143335 None None 241 None 3
ENSDART00000053531 Essential Splice Site 580 610 5 6
ENSDART00000143335 None None 241 None 3
Genomic Location (Zv9):
Chromosome 23 (position 31852204)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31687094
GRCz11 23 31613625
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGACCAAAGGCCGATCATTGGAACAGATCTCAAAGGAACTTGCAATGAA[G/A]TGAGTGGACATAAACACACACATTGGTTTTGGTGGTKTATAAGGACTCTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5699
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053531 Nonsense 599 610 6 6
ENSDART00000143335 None None 241 None 3
ENSDART00000053531 Nonsense 599 610 6 6
ENSDART00000143335 None None 241 None 3
Genomic Location (Zv9):
Chromosome 23 (position 31847328)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31682218
GRCz11 23 31608749
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACCTGAGAGGCACATTGCTGTGTCACAGAAGAAAACACAAAGCTAYAGCA[C/T]AGCCCTCACAGGAGGAAAAAGCCCTCGCAACAGTTTGACTTTTTACCTAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4259
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053531 Nonsense 599 610 6 6
ENSDART00000143335 None None 241 None 3
ENSDART00000053531 Nonsense 599 610 6 6
ENSDART00000143335 None None 241 None 3
Genomic Location (Zv9):
Chromosome 23 (position 31847328)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31682218
GRCz11 23 31608749
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACCTGAGAGGCACATTGCTGTGTCACAGAAGAAAACACAAAGCTAYAGCA[C/T]AGCCCTCACAGGAGGAAAAAGCCCTCGCAACAGTTTGACTTTTTACCTAG
Associated Phenotype:
Not determined