Busch Lab

ZMP

DOM3Z

Ensembl ID:
ENSDARG00000036852
Description:
dom-3 homolog Z (C. elegans) [Source:HGNC Symbol;Acc:2992]
Human Orthologue:
DOM3Z
Human Description:
dom-3 homolog Z (C. elegans) [Source:HGNC Symbol;Acc:2992]
Mouse Orthologue:
Dom3z
Mouse Description:
DOM-3 homolog Z (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1890444]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa40188 Nonsense Mutation detected in F1 DNA Not yet available
sa30842 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40188
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053502 Nonsense 223 345 3 9
ENSDART00000053502 Nonsense 223 345 3 9
Genomic Location (Zv9):
Chromosome 3 (position 61446302)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 60389192
GRCz11 3 60851020
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGACCCCGATGCTCCTCCGGCTCCGGGATGTTATGTGGAGCTCAAGACTT[C/A]AGCAGAGATCTGCACCCCCAAACAACGCAGCAACTTCCACAGGTGACTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30842
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053502 Nonsense 223 345 3 9
ENSDART00000053502 Nonsense 223 345 3 9
Genomic Location (Zv9):
Chromosome 3 (position 61446302)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 60389192
GRCz11 3 60851020
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGACCCCGATGCTCCTCCGGCTCCGGGATGTTATGTGGAGCTCAAGACTT[C/A]AGCAGAGATCTGCACCCCCAAACAACGCAGCAACTTCCACAGGTGACTGC
Associated Phenotype:
Not determined