Busch Lab

ZMP

ankrd52

Ensembl ID:
ENSDARG00000036826
ZFIN ID:
ZDB-GENE-050522-247
Description:
Serine/threonine-protein phosphatase 6 regulatory ankyrin repeat subunit C [Source:UniProtKB/Swiss-P
Human Orthologue:
ANKRD52
Human Description:
ankyrin repeat domain 52 [Source:HGNC Symbol;Acc:26614]
Mouse Orthologues:
Ankrd52, E230028L10Rik
Mouse Descriptions:
RIKEN cDNA E230028L10 gene Gene [Source:MGI Symbol;Acc:MGI:2685285]
ankyrin repeat domain 52 Gene [Source:MGI Symbol;Acc:MGI:2444029]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa24380 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24380
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032861 Essential Splice Site 328 1071 9 28
Genomic Location (Zv9):
Chromosome 23 (position 32619246)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 32454136
GRCz11 23 32380667
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCAGCCATTCATGGACGTTTCACTCGCTCTCAGATCCTCATTCAGAATG[G/T]TTAGTTTTTTCTTTTTCTAATTGATTTTCATTTGTTTTTATGAGCTGTAA
Long Flanking Sequence:
TTCCCCGGAGAAGTAAGATCATTGGTTTACAGCATGTTTTCTTTACAATATATATTTATGTCTGTTCCTCAGATTGATGAGCCTAATGCCTTTGGAAACACTGCTCTCCATGTGGCCTGTTACACGGGACAGGAGGCCGTAGCCAACGAGCTGGTCAACCGTGGGGCCAATGTCAACCAGCCCAACCACCGTGGCTACACCCCCCTGCACCTCGCTGCCGTGTCCACCAACGGGGCTCTCTGCCTGGAGCTGCTGGTCAACAACGGTGCTGATGTCAACATGCAGGTCTGGTTTGCCAAAGACAACATTTTTATTTTTATTTTTTCTTGTTTCAGTAATATTAATAATCAGTGATGAATATACTTATGAATAATCAGCTATAAGTATATTTGATTGCATGTTTCGTTTGTCTTTTCTGCAGAGTAAAGAAGGGAAAAGCCCTTTGCACATGGCAGCCATTCATGGACGTTTCACTCGCTCTCAGATCCTCATTCAGAATG[G/T]TTAGTTTTTTCTTTTTCTAATTGATTTTCATTTGTTTTTATGAGCTGTAACTATCTCTGACTCCTGCTGTCGCCTTTTCAGGTGGGGAGATAGACTGTGTGGACAGATATGGCAATACTCCTCTTCATGTTGCTGCTAAGTACGGCCATGAGCTGCTTATTAGCACCTTAATGACAAATGGTGCTGATACAGCCAGGTAAAAAAAACATGCATTTGTAGAATATGATTTGTTTTGCTTTTTTCTATTTGTAAGCTTTGAAACAAGTGATAAACAAATGCCAAACTCCTCCTTCAGAGATTTTGTCTTATAAAATCTTTTTCCTTTTATCAATGTTTACATTTTAAACAAGTGGCAGGGGGAGTGTGATGCATTAAAAAAAATAAATTGAATGAAATAAAAGCTCAAACAGACTTAAGACATTTTAAGACTTGATTTGATTAAGTGATTTTACCAGATGTCATATTGGACATACAAGAATAACCCATGTTTTTTTACTCAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29977
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032861 Nonsense 349 1071 10 28
Genomic Location (Zv9):
Chromosome 23 (position 32619103)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 32453993
GRCz11 23 32380524
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACTGTGTGGACAGATATGGCAATACTCCTCTTCATGTTGCTGCTAAGTA[C/A]GGCCATGAGCTGCTTATTAGCACCTTAATGACAAATGGTGCTGATACAGC
Long Flanking Sequence:
CAACGAGCTGGTCAACCGTGGGGCCAATGTCAACCAGCCCAACCACCGTGGCTACACCCCCCTGCACCTCGCTGCCGTGTCCACCAACGGGGCTCTCTGCCTGGAGCTGCTGGTCAACAACGGTGCTGATGTCAACATGCAGGTCTGGTTTGCCAAAGACAACATTTTTATTTTTATTTTTTCTTGTTTCAGTAATATTAATAATCAGTGATGAATATACTTATGAATAATCAGCTATAAGTATATTTGATTGCATGTTTCGTTTGTCTTTTCTGCAGAGTAAAGAAGGGAAAAGCCCTTTGCACATGGCAGCCATTCATGGACGTTTCACTCGCTCTCAGATCCTCATTCAGAATGGTTAGTTTTTTCTTTTTCTAATTGATTTTCATTTGTTTTTATGAGCTGTAACTATCTCTGACTCCTGCTGTCGCCTTTTCAGGTGGGGAGATAGACTGTGTGGACAGATATGGCAATACTCCTCTTCATGTTGCTGCTAAGTA[C/A]GGCCATGAGCTGCTTATTAGCACCTTAATGACAAATGGTGCTGATACAGCCAGGTAAAAAAAACATGCATTTGTAGAATATGATTTGTTTTGCTTTTTTCTATTTGTAAGCTTTGAAACAAGTGATAAACAAATGCCAAACTCCTCCTTCAGAGATTTTGTCTTATAAAATCTTTTTCCTTTTATCAATGTTTACATTTTAAACAAGTGGCAGGGGGAGTGTGATGCATTAAAAAAAATAAATTGAATGAAATAAAAGCTCAAACAGACTTAAGACATTTTAAGACTTGATTTGATTAAGTGATTTTACCAGATGTCATATTGGACATACAAGAATAACCCATGTTTTTTTACTCAAAGGTAAAGACCCTACTCGATGTTTGTACAGCACAATTCCTCTTGCAGTTAAATATATTCTACTGGGCTGTCCTGCTTGTAATGATTCCGGAAGACTTTTTTTTATGAAATGAACTCTCTTAAGGACATTTTTTTAGCAAAGAG
Associated Phenotype:
Not determined