Busch Lab

ZMP

ATP1A3 (2 of 2)

Ensembl ID:
ENSDARG00000036815
Description:
ATPase, Na+/K+ transporting, alpha 3 polypeptide [Source:HGNC Symbol;Acc:801]
Human Orthologue:
ATP1A3
Human Description:
ATPase, Na+/K+ transporting, alpha 3 polypeptide [Source:HGNC Symbol;Acc:801]
Mouse Orthologue:
Atp1a3
Mouse Description:
ATPase, Na+/K+ transporting, alpha 3 polypeptide Gene [Source:MGI Symbol;Acc:MGI:88107]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa36052 Nonsense Mutation detected in F1 DNA Not yet available
sa9603 Nonsense Available for shipment Available now
sa8659 Nonsense Available for shipment Available now
sa22768 Nonsense Available for shipment Available now
sa6413 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7779
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011121 Essential Splice Site 1 905 1 17
ENSDART00000124130 None None 920 None 17
Genomic Location (Zv9):
Chromosome 16 (position 12404360)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 10904026
GRCz11 16 10794928
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAGTCTGTGCTGGTTGTTCTGGAAGCTCGGTATTGRTCAGCCGGTGGTG[T/C]TAGATGATACACAGGTTCCTGCTTTAATGATGACTGTTCCCCTAAAATAA
Long Flanking Sequence:
AATAATTTATTAAATTAAATTATAAACTATTTTTGAACAGTTATTTTATAGTGCAATAACATTTCACAGTTTCACAATTTGCACTGTATTTTTGATTGAATAAATGCAGCCTCGGTGAGCAGGAGAAGCTTATTTTAAAGCATTTAGAAAATGCTTTTGACTGATAGTAAGTATATATATATAAACCATTTTGAAAGGGTAAATATATTACCTTTCTAAGATATAACTTATGATAAAAGTGATAAATATATTATGTTTCTAGAATATAAAAGTACAGTAACAACAAATTGGTCTGCTTCTTTTCATACATTGTCCATCAGGGGGCTCCACTTATCCAGACACTCATGTGAGTGGTTCTGTTCCACAGGGTCTTGCCTCAGTAATTTCCTGGAAGGGAATTCACAATTCACATATCGACTGGGCAACAAGAATAGCTCTTTATTCCCCTGAGGAGTCTGTGCTGGTTGTTCTGGAAGCTCGGTATTGATCAGCCGGTGGTG[T/C]TAGATGATACACAGGTTCCTGCTTTAATGATGACTGTTCCCCTAAAATAACCCCACCTAAACCTCACGGGAGCCATTTTGGCTCTGATGGATTAATTCTATGCCACCTTCTTCCAGTATGATGGAATCACACATACAGCCAATAGAAACACAGGATTCACAAAGAGGAGTGAAAACCATACTGAAAGGTCAAAATCTGTTGATGAAAGTATAATAACCTCAACTCAAATTTCGGCTCAGATGAAATAATCCGCATGTCAGAGGAAAACAGAACTGGAATATTACACTTCACATATCCTTTGATCTTTGAATTAATTTAAATAAAGAACAAAGTGTAATGAATTAGATTTTCTCCTCTTTGAACTATCTTTTTACAGTTTACACTTTCATGTCACTTTAATGAGAAACAGACTCATACTAAACCTAATCAGATTGACTTTGATGAAAAACAAGACTCTTGCCTTTTTGTGCTGCCACAAATGACAGGGTGAGACAAATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36052
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011121 Nonsense 474 905 10 17
ENSDART00000124130 Nonsense 475 920 10 17
Genomic Location (Zv9):
Chromosome 16 (position 12414327)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 10913993
GRCz11 16 10804895
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTGTATCGAGCTGTCCAGTGGCTCAGTCAAAGCAATGAGAGAAAAGAAC[A/T]AGAAAGTAGCCGAAATCCCATTCAACTCCACCAACAAATATCAGGTTTGT
Long Flanking Sequence:
TGAATGTCTTTTTAATCTCAGGTGTGTCTCACTCTGACTGCCAAGCGAATGGCTCGCAAGAACTGCCTGGTTAAGAATCTGGAAGCCGTAGAGACGCTGGGATCCACCTCAACGATCTGCTCAGACAAGACTGGAACTCTGACCCAGAATCGAATGACTGTGGCACACATGTGGTTTGACAATCAGATCCACGAAGCCGACACCACTGAAGATCAGTCAGGTTTGTTCTTTTCTTCTGTTATGACTCAACATATGACACCTATTTTTCTATCCAGAGTCTAAGGTGATCTGTCTCTGCAGGTGCGTCGTTTGATAAGAGCTCTGTGACTTGGGTGGCTCTGGCCCGTGTGGCGGCTCTGTGTAACAGAGCTGTGTTTAAGGCGGGACAAGACTCTCTGCCCATTCTCAAGAGGGACGTAGCTGGTGACGCTTCTGAGTCTGCCCTGCTTAAGTGTATCGAGCTGTCCAGTGGCTCAGTCAAAGCAATGAGAGAAAAGAAC[A/T]AGAAAGTAGCCGAAATCCCATTCAACTCCACCAACAAATATCAGGTTTGTTATTAGTTAGACACCAAATATAAACCAAAAGAGAAGCTGAGGGATAATTCTACACACAACAATTATGAAGAAACACTCTATAAAGACGGCTGAGGTCTTGGAGTTGTTAAAAATTGTTAAATTCACTTCATTGTTATATTCACTTCATTGTTATATTCTCTGTGTACGAGCGGGTGCAGCCATTTGAATCTTTTTGGCTCGAGACTTCAGGTTTCATTCTCTTCCATTCATTTCCAGTTTTAGGCGTTAAAAACAGCTTGTTATGATGCTTGATGTTGCAAACTGATATTATCTTAGTTAATTATTCAACTCGGCCTGTTTAGTCATGCAAACACTTGTTTGTCGAGCAAGTTGTTTGACTGTTTTCTGCTGTTTATTATTCCTAGTCATTTCTCCCATAGGGAACTGAATCGGAAGTTCTAAAATATTCTTGAAAATGTGCGCACACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9603
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011121 Nonsense 635 905 12 17
ENSDART00000124130 Nonsense 636 920 12 17
ENSDART00000011121 Nonsense 635 905 12 17
ENSDART00000124130 Nonsense 636 920 12 17
Genomic Location (Zv9):
Chromosome 16 (position 12416892)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 10916558
GRCz11 16 10807460
KASP Assay ID:
2260-9279.1 (used for ordering genotyping assays)
KASP Sequence:
ATCACCCYATCACTGCCAAGGCCATCGCCAAGGGTGTGGGCATCATCTCA[G/T]AGGGTAACGARACTGTGGAAGACATCGCTGCCCGTCTCAACATCCCTGWC
Long Flanking Sequence:
ATTTAGATCTTGTTATAATTTGAATAAATTGCATTTTAAAATACATCCAGATAGAGAACCCCAAAATATAATTTTAACTGCAATAATATTTTATGTTTTTGCTGTTTTTCATCAATAAATTTAGTTTGGTGAGCATACCAGACTTTTTTTGAAAGAAAAAAAAAACTGAAATATTCCAAACTTTTCACCCAGAGTCCATAATGACACTAGAGTCTACAATATTTAAGTATGTGTAAACCTGCGTTCTTTCAACAGGATTCTGCCATGTCTTAATGCCTGAGGACCAGTACCCGAAAGGTTTCGCCTTTGACACCGATGATGTCAATTTCCAGACAGACAACCTTTGCTTTGTGGGCTTGATGTCTATGATTGACCCTCCCCGTGCTGCCGTGCCTGATGCTGTGGGAAAGTGCCGTTCCGCTGGAATCAAAGTCATCATGGTGACAGGAGATCACCCCATCACTGCCAAGGCCATCGCCAAGGGTGTGGGCATCATCTCA[G/T]AGGGTAACGAAACTGTGGAAGACATCGCTGCCCGTCTCAACATCCCTGTCAGTCAGGTCAATCCCAGGTAAAACACTGAGCAGCACTGAAAACATCACATAGCACATCAACATGGTGCGGTGGTATAAGTTCAGTTTATGCTGACTACCAATGTGTGAATATAATCACAGGTCAGAAATAGATATTTAAGCAACTAAATACATGTAATACTACCCCTAAAGCACTTTTGGTTTGTTTTTGGATTATTAATATTGAACTTTTTTTTTTGTAGAAAAGTACTTTGGAGCATGCAAGAAGTTAAAGGCTCACTGTACAAAATACTGGGTTCCACACTAGTGATCTGTGTTGGGACAACTTAAAGGAAATAAGTTAACTTATTAAGTTTTACAGATTTTAGTTGATTGAACAAAACAAATGTCACAAAAAAAACAGGATTTGTGTTGTTTCAACTCCTTTTTAATAACTACTTTTAACAAACAGCAAACATGATCATTTTTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8659
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011121 Nonsense 635 905 12 17
ENSDART00000124130 Nonsense 636 920 12 17
ENSDART00000011121 Nonsense 635 905 12 17
ENSDART00000124130 Nonsense 636 920 12 17
Genomic Location (Zv9):
Chromosome 16 (position 12416892)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 10916558
GRCz11 16 10807460
KASP Assay ID:
2260-9279.1 (used for ordering genotyping assays)
KASP Sequence:
ATCACCCYATCACTGCCAAGGCCATCGCCAAGGGTGTGGGCATCATCTCA[G/T]AGGGTAACGARACTGTGGAAGACATCGCTGCCCGTCTCAACATCCCTGWC
Long Flanking Sequence:
ATTTAGATCTTGTTATAATTTGAATAAATTGCATTTTAAAATACATCCAGATAGAGAACCCCAAAATATAATTTTAACTGCAATAATATTTTATGTTTTTGCTGTTTTTCATCAATAAATTTAGTTTGGTGAGCATACCAGACTTTTTTTGAAAGAAAAAAAAAACTGAAATATTCCAAACTTTTCACCCAGAGTCCATAATGACACTAGAGTCTACAATATTTAAGTATGTGTAAACCTGCGTTCTTTCAACAGGATTCTGCCATGTCTTAATGCCTGAGGACCAGTACCCGAAAGGTTTCGCCTTTGACACCGATGATGTCAATTTCCAGACAGACAACCTTTGCTTTGTGGGCTTGATGTCTATGATTGACCCTCCCCGTGCTGCCGTGCCTGATGCTGTGGGAAAGTGCCGTTCCGCTGGAATCAAAGTCATCATGGTGACAGGAGATCACCCCATCACTGCCAAGGCCATCGCCAAGGGTGTGGGCATCATCTCA[G/T]AGGGTAACGAAACTGTGGAAGACATCGCTGCCCGTCTCAACATCCCTGTCAGTCAGGTCAATCCCAGGTAAAACACTGAGCAGCACTGAAAACATCACATAGCACATCAACATGGTGCGGTGGTATAAGTTCAGTTTATGCTGACTACCAATGTGTGAATATAATCACAGGTCAGAAATAGATATTTAAGCAACTAAATACATGTAATACTACCCCTAAAGCACTTTTGGTTTGTTTTTGGATTATTAATATTGAACTTTTTTTTTTGTAGAAAAGTACTTTGGAGCATGCAAGAAGTTAAAGGCTCACTGTACAAAATACTGGGTTCCACACTAGTGATCTGTGTTGGGACAACTTAAAGGAAATAAGTTAACTTATTAAGTTTTACAGATTTTAGTTGATTGAACAAAACAAATGTCACAAAAAAAACAGGATTTGTGTTGTTTCAACTCCTTTTTAATAACTACTTTTAACAAACAGCAAACATGATCATTTTTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22768
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011121 Nonsense 662 905 13 17
ENSDART00000124130 Nonsense 663 920 13 17
Genomic Location (Zv9):
Chromosome 16 (position 12418903)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 10918569
GRCz11 16 10809471
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTATTTATCAAGAATTTCTTGTTTGTATGTTTTAGGGATGCCAAAGCCTG[T/A]GTTATACATGGAACAGATCTGAAAGACTATTCTCAGGAGCAAATAGATGA
Long Flanking Sequence:
AGAACTCTGGGATCAGTTTAACTTTTTAAAAAGCATTTTAAGACACACCTTTTTGGTCAAGCTTTTAATTAACAGTATTAGTGTTTTTGTATTTTAAATTTTAATTAGTCTTAATATGTTTTGACATGCCTTCTTTTATTGTCATGTGTTCTTTTACTTGTTTTCACTTATTGTAAAGCACTTTGCGACTCAATGTCTGGGAAAGGTGCTATATAAATAAAATTTACTTACTTACTTACTTACTTACTTACTTACTTACTTACTTACTTACTTACACAGAAAACGCTTTTAATCCAAGCAACTTTTGTTAGTAAAATCTGTACAATTGCAAAAACAGCTTCATTGCATTGCAAAAAGTCAATCACCTAGATTCCTATTGAAACAACTGTATTTAACCCAAAAATGTACCAGGCAATGTGTGCACCTTTACTTAAACCAACAAATACTTCTGTATTTATCAAGAATTTCTTGTTTGTATGTTTTAGGGATGCCAAAGCCTG[T/A]GTTATACATGGAACAGATCTGAAAGACTATTCTCAGGAGCAAATAGATGAAGTTCTGCGAAACCACACTGAGATTGTGTTTGCCAGGACGTCTCCCCAGCAAAAACTTATCATTGTAGAAGGCTGCCAGCGACAGGTAAACACACATACAGGCATTCAAGTCTACTGTCTTCAAAAGCCCCATTTACACCTGATACTAAATTGATAGTTCACCTGAAAATGAAAATTCTGTCATCATTTACTCATCCTCTACTTGTTCCAAAACTCTCTCACAGATACAGATATTCTGAAGAATGCTGGAAAAAACAACTACTGACTTCCATGGTATTTTTTGTTCCTACTAAGTATGGCTGCTTTTTACCAGCATTCATCAGAATATCTTATTTTTTGTTCAAAAGAAAAAAGAAATTCATAAAAGTTTAGAACCGCTTGAGCGTAAGTAAATCATAAGGAAATTTACTATTCCTTACTATGATTTTTTGTCAAAATAATCACAAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6413
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011121 Essential Splice Site 815 905 15 17
ENSDART00000124130 Essential Splice Site 816 920 15 17
Genomic Location (Zv9):
Chromosome 16 (position 12422653)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 10922319
GRCz11 16 10813221
KASP Assay ID:
554-4031.1 (used for ordering genotyping assays)
KASP Sequence:
GCCCCTCGGCACCATMACCATCCTCTGTATCGACCTGGGAACTGACATGG[T/G]GAGCATTAGTATTAGCCTTAGTATAGAAATAYTATGTTCTGATATCCTRA
Long Flanking Sequence:
ATGTAATCTCAACACTGGTGGTCACAAGAGACACATCTGAACACGTGTTAATCCCATGTTTCACCCCTGTCCTGTTTCTCGTTCTGTCTCTCAGGGGGCCATCGTGGCTGTAACAGGTGATGGTGTGAATGACTCTCCAGCCCTGAAGAAGGCTGATATCGGCGTCGCTATGGGCATTTCTGGCTCTGATGTGTCTAAACAGGCTGCTGACATGATTTTGCTGGATGACAACTTCGCCTCCATCGTCACTGGAGTAGAAGAAGGTGAGTCAGACAGTGAAGTACATGGAAAGGCAGGAGACAAGTTGTCAAACACAATGTATAAATCCATTTCTCCTCTCGCAGGTCGACTCATCTTTGATAATTTGAAGAAGTCTATTGCGTACACCCTGACCAGCAATATCCCTGAGATCACCCCATTCCTGCTGTTTATTATTGTCAATATTCCCCTGCCCCTCGGCACCATCACCATCCTCTGTATCGACCTGGGAACTGACATGG[T/G]GAGCATTAGTATTAGCCTTAGTATAGAAATATTATGTTCTGATATCCTGATGCTTAAGTTTATACACTTTCTTTTTCTTCTGCCTCTTTAGGTACCTGCAATTTCTTTAGCTTATGAAGCAGCTGAGAGTGACATCATGAAGAGGCAGCCCAGGAACCCTATGAGAGACAAACTTGTGAACGAACGTCTCATCAGCATCGCTTATGGACAGATCGGTTGGTCTCATTCTGCATGAAACTGTAGATTTGGCTTCATTTTAAGTCAATGTGCCATATTAAAAAGGGTAGTTAGCTTTGTTAGCAAGTTATTTTTATTTATTAATTTTTTTTATTCATTGAAATCATGGAAATGAAGAAAATTCTGGGGGAAAATCATACTTCTACGCTGATTTAATAGATTTTTTTTCATTATAAAAGTTCAGTTGTTTACTTATTTACTACTTTATAGTCAGATATTATATCTTTAAACACTGAACAGATTTTATTTATAGATTTAATCAC
Associated Phenotype:
Not determined