Busch Lab

ZMP

abcb3l1

Ensembl ID:
ENSDARG00000036787
ZFIN IDs:
ZDB-GENE-030616-245, ZDB-GENE-990415-260
Description:
ATP-binding cassette, sub-family B (MDR/TAP), member 3 like 1 [Source:RefSeq peptide;Acc:NP_0010065
Human Orthologues:
TAP2, XXbac-BPG246D15.9
Human Descriptions:
Truncated antigen peptide transporter 2 [Source:UniProtKB/TrEMBL;Acc:B6VNV2]
transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) [Source:HGNC Symbol;Acc:44]
Mouse Orthologue:
Tap2
Mouse Description:
transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) Gene [Source:MGI Symbol;Acc:MGI:98484]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa1788 Nonsense Available for shipment Available now
sa43214 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa412 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1788
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Founder:
mrf134
KASP Assay Location:
Project 554.16, Plate 4, Well B05
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031380 Nonsense 3 725 1 11
Genomic Location (Zv9):
Chromosome 19 (position 7746943)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7205482
GRCz11 19 7124407
KASP Assay ID:
554-1781.1 (used for ordering genotyping assays)
KASP Sequence:
ATAGCGTTTCGGTGTTACCACGGCAACCAGTTTACGCACGCACCATGCGG[A/T]AGGTTTTGGTGTTCGCGTGTATGTTATGTTTTGACATCTTAATAGTTTTG
Long Flanking Sequence:
GACTACAACACACCACCTAGTATTAATAAACCACTCTCACGAGTTAGTAACGACAGCAACAACATTTAAAGCATTATCTTTTAAAATGTTTTTTTTTTTTTTGGAAAAACGATACTTTCCCGGTCTTCCTTATTTATATCCATTTGCTCAGTTTGAACGTAATTTCACATGTATAAAATGCTATGGCATTAATTTGATTTAGAAAATTGGTCAACATAACAAAGCTCTCCATCGAAATCCAAACGCAAAGCGCTGCTGTGTGTGCTGTAGCCTATAAAGCAGGAAAATCCCTTACCCTGAGAAACTGAAAGTGAAAGTAAGGTCATTTCAGTGTCCTGAAATGCCCTGGCGCTGCGTAACGAAAACACACACCAGCAATCTGTAGGACGGGGCAAAACGAAGAAAATAATAACCGAAGAAGGTCGTTTATTTGGAGATATATTTTTTCCAATAGCGTTTCGGTGTTACCACGGCAACCAGTTTACGCACGCACCATGCGG[A/T]AGGTTTTGGTGTTCGCGTGTATGTTATGTTTTGACATCTTAATAGTTTTGATACTGGACCTCGCAGAAACTTTGCTCAAGTCTCCAACAAGCAGTTTGGACTATAATCTGTTTCGCCAATGGGCTGAATCTGGATTGCGATGCACGCTGCTGTACGCGGGGTCTACTTTATCTAAAGATGCGGCAGATCCTTTGATAAGAAGATGGATTACTGTCCACTGTTTTATCGGTTCGGTATACGAAACCGGACGCTTAGCGATGTTTAACAACTACCGTCTTGATAAATTCACTGTGTGGCTTGTCGGTACAGTTGCTGCGGCTTTAGCGTGTCTCTTTTGGGAGATAACACTGCCTGACACAAATGAAGGGAGTAACGGTAAAGAGCGCAAACAGAAGGCTCGAGTCCTCTTCATCCGGGTCATCCGTTTATACAGGCCAGATTATATATTATTATTTGGAGCTTTTGTGTTTCTGGCCCTAGCTGTGCTATGTGAGTATTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43214
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Founder:
SL7_02_C8
KASP Assay Location:
Unknown
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031380 Essential Splice Site 382 725 5 11
Genomic Location (Zv9):
Chromosome 19 (position 7748469)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7207008
GRCz11 19 7125933
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAAAGACCCGACGGGACACAGTCAGGGCGATTTACCTGCTAATTAGGAGG[G/A]TCAGTATTTGTTTATTTTCTCTGAAGGAAACTTTTGATATTATATTGCTT
Long Flanking Sequence:
TACTCTGATGGGCCGGGCTGTAGCCCTGAATGTCAACGTTCTTCTGCGGACACTTGTAAAGACATTAGGAATGCTGTATCTGATGGTGAGCCTCTCCTGGAAGCTTACACTACTGATGCTGATGGAGACGCCACTGACAGGCTTACTGCAGAACATATATGACACACACTATCAGGTAACGTGCAGATAAAAACGTGAAGGATGATGGAAAATTATTTATGCACATATGAGTATACCCTATATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATGCATTCTTTAGAAGCTCTCAAAAGAAGTTCAGGACTCCATGGCACAAGCTAATGATGCTGCTGGGGAGGCAGTTTCAGGGATCAGGACAGTAAAGAGTTTCAAGACAGAACTTGGTGAAGCCCATCGCTATGATGGCCGTTTGATGGAAACTCACAATCTAAAGACCCGACGGGACACAGTCAGGGCGATTTACCTGCTAATTAGGAGG[G/A]TCAGTATTTGTTTATTTTCTCTGAAGGAAACTTTTGATATTATATTGCTTTGATATTGATTATATCTTCTTGATATTTGGGATGTTTGCAGATGACAGAATTGGGAATGAAGGTGGCCATGCTTTACTATGGGAGACTGTTCATCCAGTATGGACAGATGAGCACTGGGAATCTGGTTTCTTTCATTCTGTATCAGCAAGACCTTGGAGACAACATTAGAGTAAGTCTGGTTACTTTAAAAAAAGGTTGCTTAATAAAAGGGTCAAGTAAAGTTGAATGACCCTATTCACAGCATTAACAAAACCATTTTCAGCATGATAAAAATGTGTCCATCTCTATTCCCAGACTTTGATCTACATCTTTGGAGACATGCTGAATTCAGTAGGGGCTGCTGGTAAGGTGTTTGAGTACCAGGACCGAAAGTCTGAAGTCAGTATTGATGGAAATCTGATGCCAAAAGATCTGAAAGGACACGTCAAGTTTCAGAATCTCACCTTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa412
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Founder:
mrf139
KASP Assay Location:
Project 554.12, Plate 2, Well D02
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031380 Nonsense 443 725 7 11
Genomic Location (Zv9):
Chromosome 19 (position 7748866)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7207405
GRCz11 19 7126330
KASP Assay ID:
554-0271.1 (used for ordering genotyping assays)
KASP Sequence:
CTTTGATCTACATCTTTGGAGACATGCTGAATTCAGTAGGGGCTGCTGGT[A/T]AGGTGTTTGAGTACCAGGACCGAAAGTCTGAAGTCAGTATTGATGGAAAT
Long Flanking Sequence:
AGAACTTGGTGAAGCCCATCGCTATGATGGCCGTTTGATGGAAACTCACAATCTAAAGACCCGACGGGACACAGTCAGGGCGATTTACCTGCTAATTAGGAGGGTCAGTATTTGTTTATTTTCTCTGAAGGAAACTTTTGATATTATATTGCTTTGATATTGATTATATCTTCTTGATATTTGGGATGTTTGCAGATGACAGAATTGGGAATGAAGGTGGCCATGCTTTACTATGGGAGACTGTTCATCCAGTATGGACAGATGAGCACTGGGAATCTGGTTTCTTTCATTCTGTATCAGCAAGACCTTGGAGACAACATTAGAGTAAGTCTGGTTACTTTAAAAAAAGGTTGCTTAATAAAAGGGTCAAGTAAAGTTGAATGACCCTATTCACAGCATTAACAAAACCATTTTCAGCATGATAAAAATGTGTCCATCTCTATTCCCAGACTTTGATCTACATCTTTGGAGACATGCTGAATTCAGTAGGGGCTGCTGGT[A/T]AGGTGTTTGAGTACCAGGACCGAAAGTCTGAAGTCAGTATTGATGGAAATCTGATGCCAAAAGATCTGAAAGGACACGTCAAGTTTCAGAATCTCACCTTCTCGTATCCCAGAAGACCCGACCACAATGTGTTAAAGGTAGTGTTTACTGACGAATCACATTACTTGATGCATGTCAAATATTAAAATGCAATTCACATTAAAAGGGGCAGTTCACCCAAAAATGAAAATACTGTCATCAATTTCTCACCCTTAACTTGTTTAAAACCTGTTTGAGTTTCTTTCTTCTGTTGAACACAAAAAAATGATGTATGCAAAATTCTGGTTGCTGGGAATTTTCCATAATAATAGCTTTTTTGTGTTTAACAGAAGAAAGAAACGCATAAATGTTTAAAACTGTATGAGGGCGAGTGAATAGTAATTATGTTTAAAAATATATTCTTTTTTTAAGAGTATGGCAGTTTAAGTTTAAGTTTTTTTAAGAGCCCAGTGGCATTTTGA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461