Busch Lab

ZMP

aldh8a1

Ensembl ID:
ENSDARG00000036776
ZFIN ID:
ZDB-GENE-040912-3
Description:
Aldehyde dehydrogenase family 8 member A1 [Source:UniProtKB/Swiss-Prot;Acc:Q66I21]
Human Orthologue:
ALDH8A1
Human Description:
aldehyde dehydrogenase 8 family, member A1 [Source:HGNC Symbol;Acc:15471]
Mouse Orthologue:
Aldh8a1
Mouse Description:
aldehyde dehydrogenase 8 family, member A1 Gene [Source:MGI Symbol;Acc:MGI:2653900]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa3225 Nonsense F2 line generated Not yet available
sa44022 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29971
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053399 Nonsense 7 487 1 7
Genomic Location (Zv9):
Chromosome 23 (position 32002187)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31837077
GRCz11 23 31763608
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTTTTTTTTTATCTCAATTTTTTTTGCGATGTCAAAAGACATGAAATA[T/G]CTAGTGCTGGAAAACTACATCGGTGGGAAGTTTGTGCCATGTTCCAAGCT
Long Flanking Sequence:
AGGCAACCACGATTTCTTTGCAGTGTATGTTCGTGAACAGAATAAACTTACTTCAAATCTTTAGAAATATTAATGTTTTAAACGTTTGGCTGGTAGTTTATTTTATTAAAAAGTATCCAACAATCAAGTTATTATTTTGTAGAGTTCATTTTAAAAGCATTAAACAGTCGTCAATGTCAGGATTAAATATTTAACTCGAGACTAACATTCTGTTTTCACAGAATTGTGAATATTATCTCACCTCCATCAGCAAGTTAAGGTCTTTTAATATCCAACTCATGCTCTAATTAATGAGTGGCGTATCTGCTGGAGAAGCCGTTTAGTTTTCTTTTACAACCTATCATTTAGTTGAGTAAACATATTGCAAAAGAGTCTGGCGAAAGCTCATATGCAACACCGTGCTGAGTGCAGCGCAAAACTTTCAGATCCTCCTTTTGTTTGCCAAGCTTGATTTTTTTTTTTATCTCAATTTTTTTTGCGATGTCAAAAGACATGAAATA[T/G]CTAGTGCTGGAAAACTACATCGGTGGGAAGTTTGTGCCATGTTCCAAGCTGATCGACTCTTTCGACCCGTCAACAGGAGAAGTTTATTGCAAAGTTCCAGACAGTGGAGCTGAAGAGGTGAGAGTTTATTTTGTATTATTCTCTTTTATGTTTAAGTTGATCCTCAATGATGTTAGTTGAGCATGATCAAGTACTCTCGCTTTCACCAAAGAGATTCTATTGAAATTAGTTGAACATTTTCACCTGTTTCTAGTGTAGAGAATCATTGCAGTCTCCCATTTAATGAATATGTAACCAGTCACGCCATTGTTTGGCTTAAGACACAAATTCCAGGAATGTTCGGAGTAAAGACACTTGATGAAGTACCTTTGGTCTCGGATATTTCTCCCTGTAAACACGTTGGTCATAAAAAAGGGAAACAATCAGGTGGGCAGATGCTCAAGGTCCAGAGTTTAATTATTAAACAAGCTAAAGCTCATGCCAAAAGAACTTGTCTGGGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29970
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053399 Essential Splice Site 96 487 2 7
Genomic Location (Zv9):
Chromosome 23 (position 32001310)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31836200
GRCz11 23 31762731
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAGAGGCTCGACTGGAGGAGTTTGTTCAGGCCGAGTCTAAAGACCAGGG[T/A]AAAAATGCACTGTAATGCGGTATTATTGTACAGGGTACACTAAATGAGTC
Long Flanking Sequence:
GGATATTTCTCCCTGTAAACACGTTGGTCATAAAAAAGGGAAACAATCAGGTGGGCAGATGCTCAAGGTCCAGAGTTTAATTATTAAACAAGCTAAAGCTCATGCCAAAAGAACTTGTCTGGGTCAGTGGAGCAGAATAGAGAGTGTGTTTGAAATCCACTTATTTGGGCTGTATTGTGTTTCCTATTTTTAATTGTTTTCCTTTCATCTTTAATATATTTAATAATGCTCAAAATGACAATTTACTAACACTTCACACTCTAAGATAAATAATTTCCTCTACAAACTAATGCATCATCTCTTATTTGTTGAACTTTATAAGTAAGTTAAATATTTTCTCAATGCTCATAGGTGAATGCTGCAGTGAGGGCAGCTAAAGAGGCCTTTCCGGATTGGTCGGCTAAAAGCCCAGCTGATAGATCCAAAGTGCTGAATAAACTGGCAGACCTGATAGAGGCTCGACTGGAGGAGTTTGTTCAGGCCGAGTCTAAAGACCAGGG[T/A]AAAAATGCACTGTAATGCGGTATTATTGTACAGGGTACACTAAATGAGTCATACTATATAAGGACTCACGGCTGCACAATAGACCAAAGGTAGACAGAATTTAAGCGATTCAGCAATGTAGTCTTCACTTAATTTATGCTTTCTTTCAGTAGGATATACTGAGAGCAGAGTGTCTGATGTTTATTTTATATAATTAATTTTATGCATGCATGTACAGTTGAAGTCAGAATTATTAGCCCCCCTGAATTATTAGACCGCTTGTTTATTTTTTCCTCAATTTCTGTTTAACAGAGAGAAGATTTTTTTAACACATTTCTAAACATAATAGTTTTAATAACTTATCTCTAATAATGGATTTATTTTCTCCTCACCATGATGACAGTAAATAATATTTGACTAGATATTTTTCAAGACACTTCTATACAGCTTAAAGCTTACTTAGGTTAATTAAGGTAACTAGGCAGGTTAGGGTAATTAGGCAAGTTATTGTATAACTATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3225
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053399 Nonsense 315 487 6 7
Genomic Location (Zv9):
Chromosome 23 (position 31994747)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31829637
GRCz11 23 31756168
KASP Assay ID:
554-2957.1 (used for ordering genotyping assays)
KASP Sequence:
GCGTTTACCCAGAATTCCTCACTCGTTTTGTGGAGGCGACTCGTCGGTGG[A/T]AAACCGGGGTTCCTTCAGACCCCTCAAATGACAATGGAGCACTCATWAGC
Long Flanking Sequence:
GTGTACATACTGTACATATCAACACAAGAAGGACATCTAAATAAAAGTAAAATAAAGTAAACAATTACAATTCTGAAGTTTATTGTTGATAAGATCATTACTGTTTATGTCATACGTTTTTCACATTTACTTTATTTGTCTTAAACTAATTGAGATGACTTTATATAATTCCCTTTCTCGCCACTATGTGGTGCTCAAAATACATATTTTGTTAATCCAGCTACGTACACTATGTTCCCAAAACTCTCTCTCTCTTTCTCTCTTAGGCCTTCATTCACATTACTCACACAGACACATCATCATCACTGTGCTAATATTTAAACTGTATCCTCATAATTCACACAGCCCAATGAAAGTTGTGAGATTTACTCAACAACTCATTTGCATGTTCTTCTCCACTCTCTCAGGGTGAGATCTGCCTGTGTACCAGCCGCATCTTTGTGGAGCGGAGCGTTTACCCAGAATTCCTCACTCGTTTTGTGGAGGCGACTCGTCGGTGG[A/T]AAACCGGGGTTCCTTCAGACCCCTCAAATGACAATGGAGCACTCATTAGCAAAGAACATCTGCAGAAGGTACGGTTATAATCACACACGCAATCCTATTGATACTACATGCTATCTGTATATGATATGATATCTACACAACCAGTTAAAAGTTTGGGATAAGTAAAAATAATATATATGAACATTATTATAAAATATGTAATATTATTGTAATTTAAAAAAACTGTTTTCATATAGAAAGTAGTTTAAAATGTGAATTATTGCTCTGGTTTAAATTGAGTTGATTTTTCAGTAGGTCTATCATTACTCCAGTCTTGAGTGTCACATGATAATAAATCATAAATCATCCCAATAAGATGCTTTGCTCTTTAGGAAACTCTTGCTCTTTTGTTATTATTTGATTTTTTAAACATTTCTGTTGTGTTGCTTAATATATTATAGAATCTTTTTTTAATTAGGAAATAGAAGAATATAGGAAATTGTAAGACATATAAGGAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44022
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053399 Essential Splice Site 337 487 6 7
Genomic Location (Zv9):
Chromosome 23 (position 31994678)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31829568
GRCz11 23 31756099
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCCCTCAAATGACAATGGAGCACTCATTAGCAAAGAACATCTGCAGAAG[G/T]TACGGTTATAATCACACACGCAATCCTATTGATACTACATGCTATCTGTA
Long Flanking Sequence:
ATTCTGAAGTTTATTGTTGATAAGATCATTACTGTTTATGTCATACGTTTTTCACATTTACTTTATTTGTCTTAAACTAATTGAGATGACTTTATATAATTCCCTTTCTCGCCACTATGTGGTGCTCAAAATACATATTTTGTTAATCCAGCTACGTACACTATGTTCCCAAAACTCTCTCTCTCTTTCTCTCTTAGGCCTTCATTCACATTACTCACACAGACACATCATCATCACTGTGCTAATATTTAAACTGTATCCTCATAATTCACACAGCCCAATGAAAGTTGTGAGATTTACTCAACAACTCATTTGCATGTTCTTCTCCACTCTCTCAGGGTGAGATCTGCCTGTGTACCAGCCGCATCTTTGTGGAGCGGAGCGTTTACCCAGAATTCCTCACTCGTTTTGTGGAGGCGACTCGTCGGTGGAAAACCGGGGTTCCTTCAGACCCCTCAAATGACAATGGAGCACTCATTAGCAAAGAACATCTGCAGAAG[G/T]TACGGTTATAATCACACACGCAATCCTATTGATACTACATGCTATCTGTATATGATATGATATCTACACAACCAGTTAAAAGTTTGGGATAAGTAAAAATAATATATATGAACATTATTATAAAATATGTAATATTATTGTAATTTAAAAAAACTGTTTTCATATAGAAAGTAGTTTAAAATGTGAATTATTGCTCTGGTTTAAATTGAGTTGATTTTTCAGTAGGTCTATCATTACTCCAGTCTTGAGTGTCACATGATAATAAATCATAAATCATCCCAATAAGATGCTTTGCTCTTTAGGAAACTCTTGCTCTTTTGTTATTATTTGATTTTTTAAACATTTCTGTTGTGTTGCTTAATATATTATAGAATCTTTTTTTAATTAGGAAATAGAAGAATATAGGAAATTGTAAGACATATAAGGAAATAAATAGTGTTGGTCTTTTCATAAAATAATTCTAAAAAGTAATATATATCACAGTTTTCAGGAAATTATGA
Associated Phenotype:
Not determined