Busch Lab

ZMP

prmt10

Ensembl ID:
ENSDARG00000036755
ZFIN ID:
ZDB-GENE-080728-4
Description:
protein arginine methyltransferase 10 (putative) [Source:RefSeq peptide;Acc:NP_001124239]
Human Orthologue:
PRMT10
Human Description:
protein arginine methyltransferase 10 (putative) [Source:HGNC Symbol;Acc:25099]
Mouse Orthologue:
Prmt10
Mouse Description:
protein arginine methyltransferase 10 (putative) Gene [Source:MGI Symbol;Acc:MGI:2142651]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa32715 Nonsense Mutation detected in F1 DNA Not yet available
sa13342 Nonsense Available for shipment Available now
sa13445 Nonsense Available for shipment Available now
sa14984 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32715
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053369 Nonsense 38 859 2 13
Genomic Location (Zv9):
Chromosome 1 (position 36478880)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36038738
GRCz11 1 36770765
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGCAAGAAATGAGCTGGTGTCAAGATCCTTGGAAAGTGCTCAGCAGTG[T/A]CTGTTCAGTGAGGACTATGGCACTGCTTTTGTTCACTATCTGTTAGTTCT
Long Flanking Sequence:
TTACTTTACAGAACTACTTACTCCAGTATACCTAAACTGACACAAATGGAACAAACACAAATGGAAAAACTAAAAAGAAAGTTCATAAACAATAAATAAGCAGTGATGAACTTTGTTTATTTATTTATTGAACTTTTTTTCAGAAATCAATTCTTAAGATATTTTTGACTAGGTAGATGTATATTGATTTAAGAATGTTTGGGAAGTTATAATAGACATGGCAAAAATACTTTTGATATTTTAAATTATTTGACTATTTACTTATTAATTGAAGTTTATTTTTCATTATTTATTTATTTATCATTATTGTTATTATTAATATTTGCAATGCATTTTTTTTCAATTAACCAGTTGTTTGTGATCTTGATTTTGTCCTTCACAGAAGAGATGCCTAATGCCACTACAAGACCAAAGAGAACGAGGCGTCATAGACGAGCTCAGAGGGAAGATGCTGCAAGAAATGAGCTGGTGTCAAGATCCTTGGAAAGTGCTCAGCAGTG[T/A]CTGTTCAGTGAGGACTATGGCACTGCTTTTGTTCACTATCTGTTAGTTCTCAACCTCGCTCCAGCTCTGAAAGACTTTGCTAATGTAACTTTTTTTTTCTTCCATCCCTCCTTAATTATTTAATCACTGTTTAATTTCTGATCAGTCTGTGGAGTACAGAAATGTGGAGTTTAGTGATTTATTTTTGATATAGATTCAAACGTTTTTTAAAGTTTTTTTAACGCTTTTTTTTTTTTTTGTATTTACAGGAGTCATTTAGATTTACCTTGTTTAAATGGGCAGAAGAGCTGGACTCTCTTGGACGTATCCAGGACCTCTTTGATTGCTATGAACAAGCTATGGAATTGTTTCCTGTAGATGAGATTATAGTGAACAGCATGGGAGAGCACCTCTTCAGGTTTTGTTTATTTTTATTCATTTATTTATTGCCTGGTCTTGCTCTTGTTGTTTAGTGGTTTTAAGATAACAAATATATATGTATACATTATAAAAAATATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13342
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053369 Nonsense 264 859 6 13
Genomic Location (Zv9):
Chromosome 1 (position 36474306)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36034164
GRCz11 1 36766191
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCTCTCWTCAGAGTGTCGCTGGTTGTTACAGAGACTGTAGATGCAGGGY[T/A]GTTTGGTGAAGGCATCATTGAGACGYWGATTCATGCATGGAAGCACCTGC
Long Flanking Sequence:
ATCATTATACAATAACTTGCCTAATTACCCTAACCTGCCTAGCTAACCTAATTAACCTAGTTAAACCTTTAAATGTTACTTTAAGCTGTATAGAAGTGTCTTGAAATATATCTAGTAAAATATTATGTAATGTCATCATGACAAAGATAAAATAAACCAGTTATTAGAAATTAGTTATTAAACATATGTTTAGAAATGTGTTGAAAAAAAATCTTCTCTCTGTTAAACAGAAATTGGGGGTGAAAAATAAACAGGGGGGCTAATAATTGTGACTTCAACTGTACATACTGTGCAAAATGTCCTTGTTCTGTTAAAAAGCATTTGGGCCATATTTGAAAAAGAGAAGGGCCAATAATTTTATCATTAATCATTTAAACAATTTTTTTTGGTAGCTAAGGAGAAGTGATATGATATACATATACATAATACAAATTAACCTGTATTAAATGTCTCTCTCTTCAGAGTGTCGCTGGTTGTTACAGAGACTGTAGATGCAGGGT[T/A]GTTTGGTGAAGGCATCATTGAGACGTTGATTCATGCATGGAAGCACCTGCTCCTACCTGCTCCTGTAAGTCACTTTCTCATCGATTTCAGCATGTTTCTGTGCTTTAACTATTCTGATCAGTAAACCTACCGGGGTCATGTGATGCCGCAAACTAAACTCTCATTATAGAATAATCCTTTTATACAAATGACTTTATCCTGTCTGATCCCAAGTTGATCCGACCATGGTCAGAGATTTTTGTCTCTGAAAATGTTACGTCTTGCGGCTATGTTAACAGCTACCTTAGCAAAAGTTTACATACTCGAATCCTTTATTCAAAATCATTCGTTTTGATACAGTTTAACTTGTTTTTTGTTTTAGTGTTAAGAGATTTCTGAATCCTCGTGTTATTTTACTGTTGAGACAATAGGGACACCTAGCGGCTACCTGATATAAATACATTTGTTTTATTTTTGAAATGGTGTATGTTTTATAATCAAGGTTCATTTATTCATTCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13445
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053369 Nonsense 273 859 6 13
Genomic Location (Zv9):
Chromosome 1 (position 36474279)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36034137
GRCz11 1 36766164
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACAGAGACTGTAGATGCAGGGYWGTTTGGTGAAGGCATCATTGAGACGY[T/A]GATTCATGCATGGAAGCACCTGCTCCTACCTSCTCCTGTAAGTCACTTTC
Long Flanking Sequence:
CCCTAACCTGCCTAGCTAACCTAATTAACCTAGTTAAACCTTTAAATGTTACTTTAAGCTGTATAGAAGTGTCTTGAAATATATCTAGTAAAATATTATGTAATGTCATCATGACAAAGATAAAATAAACCAGTTATTAGAAATTAGTTATTAAACATATGTTTAGAAATGTGTTGAAAAAAAATCTTCTCTCTGTTAAACAGAAATTGGGGGTGAAAAATAAACAGGGGGGCTAATAATTGTGACTTCAACTGTACATACTGTGCAAAATGTCCTTGTTCTGTTAAAAAGCATTTGGGCCATATTTGAAAAAGAGAAGGGCCAATAATTTTATCATTAATCATTTAAACAATTTTTTTTGGTAGCTAAGGAGAAGTGATATGATATACATATACATAATACAAATTAACCTGTATTAAATGTCTCTCTCTTCAGAGTGTCGCTGGTTGTTACAGAGACTGTAGATGCAGGGTTGTTTGGTGAAGGCATCATTGAGACGT[T/A]GATTCATGCATGGAAGCACCTGCTCCTACCTGCTCCTGTAAGTCACTTTCTCATCGATTTCAGCATGTTTCTGTGCTTTAACTATTCTGATCAGTAAACCTACCGGGGTCATGTGATGCCGCAAACTAAACTCTCATTATAGAATAATCCTTTTATACAAATGACTTTATCCTGTCTGATCCCAAGTTGATCCGACCATGGTCAGAGATTTTTGTCTCTGAAAATGTTACGTCTTGCGGCTATGTTAACAGCTACCTTAGCAAAAGTTTACATACTCGAATCCTTTATTCAAAATCATTCGTTTTGATACAGTTTAACTTGTTTTTTGTTTTAGTGTTAAGAGATTTCTGAATCCTCGTGTTATTTTACTGTTGAGACAATAGGGACACCTAGCGGCTACCTGATATAAATACATTTGTTTTATTTTTGAAATGGTGTATGTTTTATAATCAAGGTTCATTTATTCATTCAGCTTTTTCACTTTGTCATCATATAAGTAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3349
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053369 Nonsense 679 859 11 13
Genomic Location (Zv9):
Chromosome 1 (position 36461045)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36020903
GRCz11 1 36752930
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTTCRGTTTGTAAACAGTAGTTTGTTTGGTSAACATTTCAGGTGTTTGT[T/A]GGAGGACGGTGGACAGATTTTTCCAGAGCGCATTGTGATCCATGGGATGC
Long Flanking Sequence:
AAGTTAAAATAAAGTGGTTAAATGAAATTTTAATATTCCTAAATGCATTGTTAAAAATATTCAATAACTATCAATATCGAATGATATGAAACATGATATTGTGATAATTTTTTTGCAATATCGCCCAGCTCTAGTAAAAACTACTGTACATAAGGCTATATAAAGAGACTACACAAAAGCCTTAACATTTTGTATGATGCAGTGTGAGTGTGTGTGTGAGAGTGTGTCTCTGTGTGTGTGTGCATTTTAGGCTTACAGAGTGTCACTCCTTCACTCCTGTAGACTTTTTTTCAGCATCATGGTGAATTGTGAATTTGTTGGCCATTCCAATCATTCTCTCATTTTTAAAATGTCAAAAAAGCGAACTTTTTTTCTGTCTAAAATGAACAAAAAAACTACCAGAGAGTTATTTGTGGTTGGTTAATGTAGCAAATTGTCTGTGGTTCTTTTCTTTCAGTTTGTAAACAGTAGTTTGTTTGGTCAACATTTCAGGTGTTTGT[T/A]GGAGGACGGTGGACAGATTTTTCCAGAGCGCATTGTGATCCATGGGATGCTGGTAGAGTCAGACACGCTGCTTCTTGAAAACGCTGTTCAGGGAACCGAACCAACACTCGGGTTTAACATCGCTCCATTCATCAATCAATTCACAGTATGTACTGTAGCTGATCTCCATCTTTTGTCTTTGAGAACCTGGGCCCGGTTTTTCAAAAGTAATCCACTAGGATATTGGATAAGGGATTGGATCAAATCTTGAAAATGGGTTTTTCAAAAAAAAAACGGATTACATAATCGGATTAGATCACGTAATCCAATCTTGGTTTTGATCCGGATCAAACCTTTAGTTTGGGTTTTTCAGACCTTTTTTGTAGGATTTGGATCACTTTGATCCAAAAAACCTGGATTAAACTGATACCATCAGAAGGGTGGATTTAGCGTAGATTTCATGCCCAAAATGTAATAAAAACTTAAAAAAATATATTGAATAAAACTATATTTGGATCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14984
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053369 Nonsense 684 859 11 13
Genomic Location (Zv9):
Chromosome 1 (position 36461031)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36020889
GRCz11 1 36752916
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACRGTAGTTTGTTTGGTSAACATTTCAGGTGTTTGTWGGAGGACGGTGGA[C/T]AGATTTTTCCAGAGCGCATTGTGATCCATGGGATGCTGGTAGAGTCAGAC
Long Flanking Sequence:
TGGTTAAATGAAATTTTAATATTCCTAAATGCATTGTTAAAAATATTCAATAACTATCAATATCGAATGATATGAAACATGATATTGTGATAATTTTTTTGCAATATCGCCCAGCTCTAGTAAAAACTACTGTACATAAGGCTATATAAAGAGACTACACAAAAGCCTTAACATTTTGTATGATGCAGTGTGAGTGTGTGTGTGAGAGTGTGTCTCTGTGTGTGTGTGCATTTTAGGCTTACAGAGTGTCACTCCTTCACTCCTGTAGACTTTTTTTCAGCATCATGGTGAATTGTGAATTTGTTGGCCATTCCAATCATTCTCTCATTTTTAAAATGTCAAAAAAGCGAACTTTTTTTCTGTCTAAAATGAACAAAAAAACTACCAGAGAGTTATTTGTGGTTGGTTAATGTAGCAAATTGTCTGTGGTTCTTTTCTTTCAGTTTGTAAACAGTAGTTTGTTTGGTCAACATTTCAGGTGTTTGTTGGAGGACGGTGGA[C/T]AGATTTTTCCAGAGCGCATTGTGATCCATGGGATGCTGGTAGAGTCAGACACGCTGCTTCTTGAAAACGCTGTTCAGGGAACCGAACCAACACTCGGGTTTAACATCGCTCCATTCATCAATCAATTCACAGTATGTACTGTAGCTGATCTCCATCTTTTGTCTTTGAGAACCTGGGCCCGGTTTTTCAAAAGTAATCCACTAGGATATTGGATAAGGGATTGGATCAAATCTTGAAAATGGGTTTTTCAAAAAAAAAACGGATTACATAATCGGATTAGATCACGTAATCCAATCTTGGTTTTGATCCGGATCAAACCTTTAGTTTGGGTTTTTCAGACCTTTTTTGTAGGATTTGGATCACTTTGATCCAAAAAACCTGGATTAAACTGATACCATCAGAAGGGTGGATTTAGCGTAGATTTCATGCCCAAAATGTAATAAAAACTTAAAAAAATATATTGAATAAAACTATATTTGGATCATGCAGTATCTTACGAG
Associated Phenotype:
Not determined