Busch Lab

ZMP

slc9a3.2

Ensembl ID:
ENSDARG00000036722
ZFIN ID:
ZDB-GENE-060503-640
Description:
solute carrier family 9 (sodium/hydrogen exchanger), member 3.2 [Source:RefSeq peptide;Acc:NP_00110
Human Orthologue:
SLC9A3
Human Description:
solute carrier family 9 (sodium/hydrogen exchanger), member 3 [Source:HGNC Symbol;Acc:11073]
Mouse Orthologue:
Slc9a3
Mouse Description:
solute carrier family 9 (sodium/hydrogen exchanger), member 3 Gene [Source:MGI Symbol;Acc:MGI:105064

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa796 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa796
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085165 Essential Splice Site 88 851 1 16
Genomic Location (Zv9):
Chromosome 19 (position 11393050)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10852279
GRCz11 19 10771204
KASP Assay ID:
554-0701.1 (used for ordering genotyping assays)
KASP Sequence:
CCATACCTGGTGGCCCTGTGGATTCTGACCTGCTGGCTCTGTAAATTAGG[T/A]AAGACGGAGGACGTATAGTNNNNNNNNNNNNATACCAGCTGACTGAGCTATTTTAACATCCA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4792
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085165 Essential Splice Site 736 851 15 16
Genomic Location (Zv9):
Chromosome 19 (position 11360605)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10819834
GRCz11 19 10738759
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTGAAAAATAATTGCGGGTTCTGTTTATGGTCATTCAATTTTCCCTCTA[G/T]ACTTTGAGTTTTCTGCAGACAGCGCCTCTAGCAGTGAAAATACCGGTCAG
Associated Phenotype:
Not determined