Busch Lab

ZMP

zgc:153916

Ensembl ID:
ENSDARG00000036707
ZFIN ID:
ZDB-GENE-061013-393
Description:
hypothetical protein LOC567134 [Source:RefSeq peptide;Acc:NP_001073501]
Human Orthologue:
PKN2
Human Description:
protein kinase N2 [Source:HGNC Symbol;Acc:9406]
Mouse Orthologue:
Pkn2
Mouse Description:
protein kinase N2 Gene [Source:MGI Symbol;Acc:MGI:109211]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa45871 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa44371 Nonsense Mutation detected in F1 DNA Not yet available
sa32553 Nonsense Available for shipment Available now
sa38152 Nonsense Mutation detected in F1 DNA Not yet available
sa19376 Nonsense Mutation detected in F1 DNA Not yet available
sa24742 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa45871
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113923 Essential Splice Site 252 977 5 22
Genomic Location (Zv9):
Chromosome Zv9_scaffold3471 (position 122214)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 25351496
GRCz11 6 25342057
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAGCTATTGGGAACAGGAAAGGTGACAGAGAAGAAAGCTCATTCTGAG[G/A]TCAGTCTAAATCCTCATAGTTTTTATATAGTGTTCTCTGCATATGCTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44371
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113923 Nonsense 401 977 8 22
Genomic Location (Zv9):
Chromosome Zv9_scaffold3471 (position 113408)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 25342690
GRCz11 6 25333251
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGCAGATGAAATCAGTGCCGTTCTAAAGTTGGACAACACAGTTGTGGGA[C/T]AGACCCATTGGAAGCCAGTTAGCAACCAATCTTGGGACCAGAAGTTCACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32553
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113923 Nonsense 615 977 13 22
Genomic Location (Zv9):
Chromosome Zv9_scaffold3471 (position 103439)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 25332721
GRCz11 6 25323282
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCCTCGCGACCTTTGACTTCCTGAACAACACAGTAGCAAAACCAGATTA[T/G]GACAGTCTGGTTGAACATGAGCAGCCTGGCTTGGAACTTACTGAAATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38152
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113923 Nonsense 644 977 14 22
Genomic Location (Zv9):
Chromosome Zv9_scaffold3471 (position 103163)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 25332445
GRCz11 6 25323006
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTACATCGTGTATCAAATGTTTGTGTGCCTTCAGGGAAGAAGAGGAAGTT[C/T]AGTTCAGTTTGTCAGATTTTAAATGTGTAGCTGTTCTGGGACGTGGCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19376
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113923 Nonsense 735 977 16 22
Genomic Location (Zv9):
Chromosome Zv9_scaffold3471 (position 100371)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 25329653
GRCz11 6 25320214
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTGTTTCCAGACCAAGGAGCATGTGTGTTTCGTCATGGAGTACGCAGCT[G/T]GAGGAGACCTGATGATGCACATCCATGCAGATGTGTTTTCTGAAACGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24742
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113923 Essential Splice Site 883 977 20 22
Genomic Location (Zv9):
Chromosome Zv9_scaffold3471 (position 96137)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 25325419
GRCz11 6 25315980
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGCTATCCCAAATATCTCTCCACAGAAGCTATTTCCATAATGAGAAGGG[T/C]AAGTTCGGACAAGTCCTGTTCTGCTTTAAACCATTGACCCAAACTACACC
Associated Phenotype:
Not determined