Busch Lab

ZMP

si:ch73-15j19.1

Ensembl ID:
ENSDARG00000036687
ZFIN ID:
ZDB-GENE-090313-135
Description:
B-cell CLL/lymphoma 9 protein [Source:RefSeq peptide;Acc:NP_001005604]
Human Orthologue:
BCL9
Human Description:
B-cell CLL/lymphoma 9 [Source:HGNC Symbol;Acc:1008]
Mouse Orthologue:
Bcl9
Mouse Description:
B-cell CLL/lymphoma 9 Gene [Source:MGI Symbol;Acc:MGI:1924828]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa13893 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2002
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053284 Nonsense 487 615 9 9
ENSDART00000113559 Nonsense 487 1573 6 8
Genomic Location (Zv9):
Chromosome 1 (position 47902421)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46714082
GRCz11 1 47405314
KASP Assay ID:
554-3229.1 (used for ordering genotyping assays)
KASP Sequence:
TCGATCTACCTAAAGGTATGGATGCTAAGCTCACAGCTCAACACCACCAG[C/T]AGTTGGCACACGAAATCATGTCTAGCATGGGGGACAACCCTGAGGGCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13893
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053284 Nonsense 570 615 9 9
ENSDART00000113559 Nonsense 570 1573 6 8
Genomic Location (Zv9):
Chromosome 1 (position 47902670)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46714331
GRCz11 1 47405563
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACCGAAGAAAMCAGAACAGGGGCCTCTTCAAGCCATGATGGCCCAGTCA[C/T]AAAGTCTTGGGAAGCCAGGTGGTCCAGGAGGACCAYGTCCRGATGGTCCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25654
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053284 None None 615 None 9
ENSDART00000113559 Nonsense 769 1573 6 8
Genomic Location (Zv9):
Chromosome 1 (position 47903267)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46714928
GRCz11 1 47406160
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGGCATGTTTGGAGGTCCTGGTGGAAGGGTGGAAAGGTTTCCAAATCCA[C/T]AGTCCGTACAGGAAGCAATGTTCCATCAGGGTATGGGTGATAAACAAGGC
Associated Phenotype:
Not determined