Busch Lab

ZMP

rcbtb1

Ensembl ID:
ENSDARG00000036645
ZFIN ID:
ZDB-GENE-030131-7951
Description:
RCC1 and BTB domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_956285]
Human Orthologue:
RCBTB1
Human Description:
regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1 [Source:HGNC S
Mouse Orthologue:
Rcbtb1
Mouse Description:
regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1 Gene [Source:M

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa32747 Nonsense Mutation detected in F1 DNA Not yet available
sa19559 Nonsense Available for shipment Available now
sa16057 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32747
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053222 Nonsense 53 531 3 12
Genomic Location (Zv9):
Chromosome 1 (position 47144972)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 45956633
GRCz11 1 46647865
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGGTGTCCTGGGACAGGTGTACGTGTTGGGTTTGAACTGCAGTAACTG[T/A]CTGGGCACTGGAGACAGTCAGAGCACCATCGCTCCAAAAAAGCTGGACTG
Long Flanking Sequence:
GATCGTCATTGGCTGCTAATATGATTTTCCCATTAAGAATTTGCAAAGAATACTTGCCTGAAACTATATTAATAATAAAAATGTGTAAAAATAAATACCAACCTCACCTCAGTCTTTTGACAAGTAATGTGAATTCCTGTAAACCTGTGATATTTAACCTATATGTCCAGTTTCACAATTCAGGGATCTGCCATGGTGGATGTGAGTAAGTGGCCTCTCTTCACCCTCTTGAGTGCACAGGAGCTCTCCTCTATTCGACAGGCATGCATCTTTGGCGCGTCTGCGAATGAGGCCATCTACATCACCCACGATGATGAAGTAAGCTGACTGCGAAACTGATAGTGTCTTCTTTGTCTGTGTGGGTCTTCAGTGTACTGTTTCAGTAGTTTATATACTGGTAACGAAATAAAGGGTCACTATGCGCTTCAGTTTGTCCATATGAAAACTGATCTGGGTGTCCTGGGACAGGTGTACGTGTTGGGTTTGAACTGCAGTAACTG[T/A]CTGGGCACTGGAGACAGTCAGAGCACCATCGCTCCAAAAAAGCTGGACTGCCTGAGTGGGAAGAAGCTGATCAGTTTGAGCTATGGCAGCGGACCTCATGTTTTGCTGGTCACTGAAGGTGAGTAGAAGTGTAAATCCTTGTTGACTCGTCTCTAGTTTTTAGAGAGAGTGTTTCCATGGGTCATGGAGCTTTCATGGAATTAAAAAAAAATATTTTCTAGACATTTAAAGTTCGGAAATTATTACTTTTTTATTTTTTTATTTTTTATTATTATAATTTTTTTTTCCATTTCTTGGAATATAATGGTCCAGATTGTTATGGTACGGGTCATCTTTATCAGGCTTGCGTTTTCACTGCCAAAAGGGTACCAATCACAAAGCAGATGCTTTATACACAAAAATACTTGTGTATAAATGTTGATGTTCATAGAAACGTTAGAAATGATTTCATTATAACTGCAGATCAATTACAGTGCAATATAGCCTACTGTAACCTCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19559
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053222 Nonsense 172 531 5 12
Genomic Location (Zv9):
Chromosome 1 (position 47139993)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 45951654
GRCz11 1 46642886
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAACTGTGGTCAGGTGGGTTCAGGGTCCACTGCCAACCAGCCTACACCA[C/T]GAAAAGTCTCCAACTGTCTGCAGAACAAAGTGATTGTTAATATAGCCTGT
Long Flanking Sequence:
TTGCTCTTAACAAACTTAATAAAAGATGTAGCCTAATGATGTCTTCAGTGGAGTGCGTACAACACAGTTTCCTTATCCAAGAAAATAAAGAAGAAAAGAGAAAGTAAAGAGGCCGAATGGAGGAGGCTCGTTCTTTATCCTCGCGCTGCAGATGGTCTGTTTAACTGTTTTCTCGCTATTGAAGTGTTCAGTTTTTACACTTACAAAGTCCGCCATGTAAATAGCAAATGTGCCATGGCGCGACGCAACTGACTCTTAAAGGGAATAGGAGGTGGGTATATTATGAGAAAATGAAAGTCTTTTTAATCTGAGATGAATAGTGTGTAGTATGAAACCTCCAAAACAAATGTAGGAACATTTAAAATAGAATAACAGGGGCATCCATTAATTATCTGTAAACCTTAATGGATGCTAATTGTATGCTGTTTTAGGTGTTCGCATGGGGCTACAATAACTGTGGTCAGGTGGGTTCAGGGTCCACTGCCAACCAGCCTACACCA[C/T]GAAAAGTCTCCAACTGTCTGCAGAACAAAGTGATTGTTAATATAGCCTGTGGACAGACCTCATCAATGGCTGTGACGGATAATGGTGAGGTAAGGGATAAAATTTACCCAACTTAGAGCTCGCCATTAGTTGAAATACTTAGCCTTATACTTCAAAAATTATCTTGACTATTGACTTATCTGTCTGCATGTGTCTTCTTGCTGTATCTGTGTTGTGTGTTGGTTAGTGGTGAAATGTGTTTGTGTGTGTGTGTTTCAGGTTTACGGCTGGGGTTACAATGGTAATGGCCAGCTGGGGTTGGGCAACAATGGGAACCAGCTCACGCCATGCCGTTTGATTGCACTACAAGGCTTCTGTGTGCTGCAGGTATATACTAAAAAGCTTTTGTGTTCCCAGATTGTTAGCTGCATGTGTAATATACTTATATACAATATTGTTCAAACCTTTTGGGTAATTTATGATGTTACAAACTATTTTGGTTGCAAATAAATGCCACCTAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4864
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053222 Essential Splice Site 201 531 5 12
Genomic Location (Zv9):
Chromosome 1 (position 47139903)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 45951564
GRCz11 1 46642796
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATATAGCCTGTGGACAGACCTCATCAATGGCTGTGACGGATAATGGTGAG[G/A]TAAGGGATAAAATTTACCCAACTTMGAGCTCGCCATTAGTTGAAATACTT
Long Flanking Sequence:
AAGAAAAGAGAAAGTAAAGAGGCCGAATGGAGGAGGCTCGTTCTTTATCCTCGCGCTGCAGATGGTCTGTTTAACTGTTTTCTCGCTATTGAAGTGTTCAGTTTTTACACTTACAAAGTCCGCCATGTAAATAGCAAATGTGCCATGGCGCGACGCAACTGACTCTTAAAGGGAATAGGAGGTGGGTATATTATGAGAAAATGAAAGTCTTTTTAATCTGAGATGAATAGTGTGTAGTATGAAACCTCCAAAACAAATGTAGGAACATTTAAAATAGAATAACAGGGGCATCCATTAATTATCTGTAAACCTTAATGGATGCTAATTGTATGCTGTTTTAGGTGTTCGCATGGGGCTACAATAACTGTGGTCAGGTGGGTTCAGGGTCCACTGCCAACCAGCCTACACCACGAAAAGTCTCCAACTGTCTGCAGAACAAAGTGATTGTTAATATAGCCTGTGGACAGACCTCATCAATGGCTGTGACGGATAATGGTGAG[G/A]TAAGGGATAAAATTTACCCAACTTAGAGCTCGCCATTAGTTGAAATACTTAGCCTTATACTTCAAAAATTATCTTGACTATTGACTTATCTGTCTGCATGTGTCTTCTTGCTGTATCTGTGTTGTGTGTTGGTTAGTGGTGAAATGTGTTTGTGTGTGTGTGTTTCAGGTTTACGGCTGGGGTTACAATGGTAATGGCCAGCTGGGGTTGGGCAACAATGGGAACCAGCTCACGCCATGCCGTTTGATTGCACTACAAGGCTTCTGTGTGCTGCAGGTATATACTAAAAAGCTTTTGTGTTCCCAGATTGTTAGCTGCATGTGTAATATACTTATATACAATATTGTTCAAACCTTTTGGGTAATTTATGATGTTACAAACTATTTTGGTTGCAAATAAATGCCACCTAAAGTGTACTTATTAAAAAATCCTGAAAAATGTCCACAAAATAATAGCAGGATATCTTCCTTTAACACCACATCAGTCTATTCAGAATAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16057
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053222 Nonsense 237 531 6 12
Genomic Location (Zv9):
Chromosome 1 (position 47139629)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 45951290
GRCz11 1 46642522
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACCAGCTCACGCCATGCCGTTTGATTGCACTACAAGGCTTCTGTGTGCTG[C/T]AGGTATAYACTWAAAAGCTTTTGTGTTCCCAGATTGTTAGCTGCATGTGT
Long Flanking Sequence:
TAGAATAACAGGGGCATCCATTAATTATCTGTAAACCTTAATGGATGCTAATTGTATGCTGTTTTAGGTGTTCGCATGGGGCTACAATAACTGTGGTCAGGTGGGTTCAGGGTCCACTGCCAACCAGCCTACACCACGAAAAGTCTCCAACTGTCTGCAGAACAAAGTGATTGTTAATATAGCCTGTGGACAGACCTCATCAATGGCTGTGACGGATAATGGTGAGGTAAGGGATAAAATTTACCCAACTTAGAGCTCGCCATTAGTTGAAATACTTAGCCTTATACTTCAAAAATTATCTTGACTATTGACTTATCTGTCTGCATGTGTCTTCTTGCTGTATCTGTGTTGTGTGTTGGTTAGTGGTGAAATGTGTTTGTGTGTGTGTGTTTCAGGTTTACGGCTGGGGTTACAATGGTAATGGCCAGCTGGGGTTGGGCAACAATGGGAACCAGCTCACGCCATGCCGTTTGATTGCACTACAAGGCTTCTGTGTGCTG[C/T]AGGTATATACTAAAAAGCTTTTGTGTTCCCAGATTGTTAGCTGCATGTGTAATATACTTATATACAATATTGTTCAAACCTTTTGGGTAATTTATGATGTTACAAACTATTTTGGTTGCAAATAAATGCCACCTAAAGTGTACTTATTAAAAAATCCTGAAAAATGTCCACAAAATAATAGCAGGATATCTTCCTTTAACACCACATCAGTCTATTCAGAATAAAGGCTGGATGAGACTTTAAAATCTAAAAATACACACAAATCCCACACTTTTGAACAGTAATACACAATAAGATGGTGGGAAACTATCTTTTTTTGCAGATTGCATCAGGTTATGCTCATTCGCTAGCACTGACCGATGAGGGCCTGCTGTATGCATGGGGTGCAAACACTTATGGCCAGCTGGGCACTGGCAACAAGAGTAACCAGCTCAGCCCTGTACAGGTCATGACTGAGAAAGAAAGGTAAGGTATTTTGGAAATAAATAGTACACAAATAT
Associated Phenotype:
Not determined