Busch Lab

ZMP

MGAT3 (1 of 2)

Ensembl ID:
ENSDARG00000036619
Description:
mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase [Source:HGNC Symbol;Acc:7
Human Orthologue:
MGAT3
Human Description:
mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase [Source:HGNC Symbol;Acc:7
Mouse Orthologue:
Mgat3
Mouse Description:
mannoside acetylglucosaminyltransferase 3 Gene [Source:MGI Symbol;Acc:MGI:104532]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa25324 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa33783 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa25324
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053184 Essential Splice Site 138 500 4 5
Genomic Location (Zv9):
Chromosome 6 (position 152500)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 186080
GRCz11 6 204131
KASP Assay ID:
554-7308.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTTCCGGCAGGGCACAGAAGTGGCGCCACCCAAAGACGAAACGCTAAAA[G/A]TGAAACCCAGCGCCGCAGGAGTGATCCAGCGGAGAATACTGCAGAAACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33783
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053184 Nonsense 403 500 5 5
Genomic Location (Zv9):
Chromosome 6 (position 153337)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 186917
GRCz11 6 204968
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCATGCCGGGATTTCGGAAGTACGAGAATGACACTGGACACATCCTGGTG[C/T]AGTGGTCCATCGGGAGCCCGTTTCATTTCGCAGGCTGGCACTGCTCCTGG
Associated Phenotype:
Not determined