Busch Lab

ZMP

gpr182

Ensembl ID:
ENSDARG00000036616
ZFIN ID:
ZDB-GENE-030131-2361
Description:
G-protein coupled receptor 182 [Source:RefSeq peptide;Acc:NP_001018314]
Human Orthologue:
GPR182
Human Description:
G protein-coupled receptor 182 [Source:HGNC Symbol;Acc:13708]
Mouse Orthologue:
Gpr182
Mouse Description:
G protein-coupled receptor 182 Gene [Source:MGI Symbol;Acc:MGI:109545]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa1354 Nonsense Confirmed mutation in F2 line Not yet available
sa37767 Nonsense Mutation detected in F1 DNA Not yet available
sa12195 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1354
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053189 Nonsense 64 358 2 2
Genomic Location (Zv9):
Chromosome 23 (position 36700526)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 36532003
GRCz11 23 36654464
KASP Assay ID:
554-1268.1 (used for ordering genotyping assays)
KASP Sequence:
ACTGGCAGAGAACACCATTGTAGTGTGGGTAAACTGGAAAAGACGGCATT[C/A]AGCGAATGGGGTGCTGTTCTGCATCATCAACGTGAGCTTGTCTGATTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37767
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053189 Nonsense 194 358 2 2
Genomic Location (Zv9):
Chromosome 23 (position 36700917)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 36532394
GRCz11 23 36654855
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGATGAACCGGGTTGCTACATGGTTCCTGAGCAGTACCACACAGAATG[G/A]TTTCTGTCCGTTTCCTTCCTATGCCTGATTTTCCAGTTTCTGGCTCCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12195
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053189 Nonsense 223 358 2 2
Genomic Location (Zv9):
Chromosome 23 (position 36701002)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 36532479
GRCz11 23 36654940
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTTTCTGGCTCCAGCGTCTGTCATTATAACCTGCAACTTCTTGATMGCC[A/T]GAGCCGTCCGCACTGCTCCWGAGGTCCAGAATCGTCGGGATGTCTGGTTG
Associated Phenotype:
Not determined