Busch Lab

ZMP

FAM193A

Ensembl ID:
ENSDARG00000036595
Description:
family with sequence similarity 193, member A [Source:HGNC Symbol;Acc:16822]
Human Orthologue:
FAM193A
Human Description:
family with sequence similarity 193, member A [Source:HGNC Symbol;Acc:16822]
Mouse Orthologue:
Fam193a
Mouse Description:
family with sequence similarity 193, member A Gene [Source:MGI Symbol;Acc:MGI:2447768]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa7383 Missense Mutation detected in F1 DNA Not yet available
sa18701 Nonsense Mutation detected in F1 DNA Not yet available
sa9068 Nonsense Mutation detected in F1 DNA Not yet available
sa31215 Essential Splice Site Available for shipment Available now
sa14253 Essential Splice Site Available for shipment Available now
sa14151 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa7383
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > C
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075216 Missense 254 1476 5 23
Genomic Location (Zv9):
Chromosome 1 (position 37177402)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36607850
GRCz11 1 37327179
KASP Assay ID:
554-4199.1 (used for ordering genotyping assays)
KASP Sequence:
GTCAGACTGGGACTCCACTGGCTGACGATCAGGATCAGCCTCTCGATCGG[G/C]ACAAAGAGAGCATGAAGGAACTTGTTGACAGGTACTCTTGAATGACTTGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25623
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075216 Essential Splice Site 264 1476 5 23
Genomic Location (Zv9):
Chromosome 1 (position 37177435)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36607883
GRCz11 1 37327212
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCAGCCTCTCGATCGGGACAAAGAGAGCATGAAGGAACTTGTTGACAGG[T/C]ACTCTTGAATGACTTGTACAGGGTTCCCTCACCTCTTGAGAGTACCTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18701
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075216 Nonsense 280 1476 6 23
ENSDART00000075216 Nonsense 280 1476 6 23
Genomic Location (Zv9):
Chromosome 1 (position 37180682)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36611130
GRCz11 1 37330459
KASP Assay ID:
2259-0817.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAGGCTTTGTGAGAAGGATCCCTACCAGTTGTACCAGCGTCTAGAACAG[C/T]AGGCAAGAGAGTACGTCTTAGAGATGAAGGTGCGGCTGCTCAAACACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9068
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075216 Nonsense 280 1476 6 23
ENSDART00000075216 Nonsense 280 1476 6 23
Genomic Location (Zv9):
Chromosome 1 (position 37180682)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36611130
GRCz11 1 37330459
KASP Assay ID:
2259-0817.1 (used for ordering genotyping assays)
KASP Sequence:
TTAGGCTTTGTGAGAAGGATCCCTACCAGTTGTACCAGCGTCTAGARCAG[C/T]AGGCAAGAGAGTACGTCTTAGAGATGAAGGTGCGGCTGCTCAAACACCTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4856
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075216 Essential Splice Site 433 1476 9 23
Genomic Location (Zv9):
Chromosome 1 (position 37186100)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36616548
GRCz11 1 37335877
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTAATGATTGGCGGCTCTTGCATCTAACGTGCAGTTTTGTCTGTTTGCA[G/T]TTGCTTTTTAAGGTTGAAGGTCAGAATCTCACAAATCAAAGGACWGAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31215
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075216 Essential Splice Site 854 1476 16 23
Genomic Location (Zv9):
Chromosome 1 (position 37197736)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36649852
GRCz11 1 37347513
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGATGAAGAACTGGAACCCTTCTGTGCTGCTCCAGGAACCACTGCCTG[G/A]TCAGTTCCATAAGCCCTTTTTAAAGATGTTTCGCCCACTTCAAAGCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14253
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075216 Essential Splice Site 1419 1476 21 23
ENSDART00000075216 Essential Splice Site 1419 1476 21 23
Genomic Location (Zv9):
Chromosome 1 (position 37209876)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36661767
GRCz11 1 37359428
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTAAGAAGAATAAGAAGAAAAAAGGAGATAAGATGAATAACTCAATAGG[T/C]YAGTTTTGTCAAGTGCTCAAGATAAATGATAAAAAGAAGGGCTTTTAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14151
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075216 Essential Splice Site 1419 1476 21 23
ENSDART00000075216 Essential Splice Site 1419 1476 21 23
Genomic Location (Zv9):
Chromosome 1 (position 37209876)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36661767
GRCz11 1 37359428
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTAAGAAGAATAAGAAGAAAAAAGGAGATAAGATGAATAACTCAATAGG[T/C]YAGTTTTGTCAAGTGCTCAAGATAAATGATAAAAAGAAGGGCTTTTAACA
Associated Phenotype:
Not determined