Busch Lab

ZMP

LOC557210

Ensembl ID:
ENSDARG00000036569
Human Orthologue:
BACH2
Human Description:
BTB and CNC homology 1, basic leucine zipper transcription factor 2 [Source:HGNC Symbol;Acc:14078]
Mouse Orthologue:
Bach2
Mouse Description:
BTB and CNC homology 2 Gene [Source:MGI Symbol;Acc:MGI:894679]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa42898 Nonsense Mutation detected in F1 DNA Not yet available
sa23029 Nonsense Available for shipment Available now
sa11743 Nonsense Available for shipment Available now
sa28828 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4704
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019017 Essential Splice Site 81 727 1 6
Genomic Location (Zv9):
Chromosome 17 (position 15554658)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15705486
GRCz11 17 15713419
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCTGCGGGGACCGACAGAACACGAGCCACTCATCAGCCTGCCAATGAAG[G/A]TGAGTGAAGGAATGGGACAAAAAACRTGATCAACAGCCCGTCTGAATGAC
Long Flanking Sequence:
AGCAAGACAATAATCCAAAACACAGCCAATAAACCTCTTAAATGGTTTCAGAAAAGGAAAGTCAAGCTGTAGAGTGGCTCAGCTAATCACTTGACTTGAATCCAGTAGAAAATACAAATTAAAAATCAGATTTGATAGATGAGACCCACAGAACTACTCAGAACAACCCTACTTGTGTATCGGCATGTTTATATCCAAGTAATGTTTTGTTCATACATTATGTCCGTTTACTTTTGTCCCCAGGCTCTGAGCAAGGAATGTCTATGGAGGAGAAGCCTGACACTCCCATGTATGTGTACGAGTCGACAGTGCATTGTGCGAACATCCTCCTGTGTCTGAATGAGCAACGGCAGCAGGACGTCCTGTGTGACGTGACGGTGCTGGTGGAGGGCAGGGAGATCCGCGCGCACAGGGCAGTGCTGGCAGCCTGTAGCCAGTATTTCTCACTGCTGCTGCGGGGACCGACAGAACACGAGCCACTCATCAGCCTGCCAATGAAG[G/A]TGAGTGAAGGAATGGGACAAAAAACATGATCAACAGCCCGTCTGAATGACCCATGCTGAAAAACTCACACACATGCGTGACTGACCAGATTTCTGAAGATTGCTGCATAATATTGAAGTCAAAATTATTCGCCCTCCTGTGAATTTCTTTTTCAAATATTTCCCAAATGATGTTTAAGAGAGCAAGGATTTATTTACAGTATTTCCTACAATATTTTTTTATTCTAGAGAAAGATTTATTTGTTTAATTCTAGCTAGAATAAAAGCAGTTTTTAATTTTTAAACACAATTTTAGGGTCAATATTATTAGCCCCCTTAAGCAATATTTTTCTTTCCAATTGTCAACAGAACAAACCATCGTTATACAATATTTTGCCTAATTAAACAAATTAACCTAGTTAAGCCTTTTAATGTCACTTTAAGCTGAATACTAGTATCTTGCAAAATATCTAGTAAAATATTGATGTTACAAGGAATTTCTATTTAAAGGCACCTGTGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42898
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019017 Nonsense 368 727 3 6
Genomic Location (Zv9):
Chromosome 17 (position 15563501)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15714329
GRCz11 17 15722262
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTCTCTCAAATCGCTTTCTCTTGAGAGGATTTGTTCACAAGATCCCGAA[C/T]AAGAGAACGACAGAAAAAGTGTCATCTTTTCCTCTCGAGGCCCCTACCAT
Long Flanking Sequence:
CGCACAGCAGTACCTCAAGCTTACAAGGCTCCCTGCAGGACACCGTCACCAGCAGCAATGCCCGAGGCCTGGATCTCTCCAAGGTAAAAGCAGAACCAGTCAATGGGGAAGTCTCTGTGCCGTTAGACTTGTCTGAGTTGGAACAGAATGGTCCGGTCAGGGGTAAAGTAATTGAGATGGACATAGAAATGGAGTTTGATGGAAGGCAACTTAGTTCAACACCCAATGAATTCCCAGCAAGCAAACGATCACCGGTGTGCCTGCGCTCCCTTGTTAAAAAGGAAGTCTCATCTTCAGATCATTGTCTTTCCACTGACCTGCAGCTTTCCAGCAGAACTTCTCCACTTCGGGAACAACAGGTTGTCACAGTTCAGGAACAACAGGTTGACTTCCAAAAGGACTATCAGGCTTTTATTGGAGGACTCTCGTCAAAGAAATTACCCGATGGAGTGTCTCTCAAATCGCTTTCTCTTGAGAGGATTTGTTCACAAGATCCCGAA[C/T]AAGAGAACGACAGAAAAAGTGTCATCTTTTCCTCTCGAGGCCCCTACCATTTGGCGCCCACACATTCATATCCTGATGAGAGTTGTTTGGGGCAGGAGACTCCAGAAGACCTGTGGGCAGGATCCAGCCAGTCGTTTCCCTGCACCCAAACTCTGTCCCCAACTTCGTCCTCTCAAGATCCCTCTTTGCCCTATCGCCGGCACCCTAAGAGCAGTTGTCCGGTGCCCATTAAAATGTGTTCCCGCTCGACTCGTGCCGATAGCCATGTCAGAACCTCCAGCTCATGCTCTTCCTACTCGTATGCAGAGGACGGCAGTGGAGGCTCTCCTTCCAGCCTGCCCCAGTTCGAGCTCTCTACCTCTCCTTGTTCCACCATGGCGCGTTGTCTGGCCCTCGAACACCGGGAGCATAGCACGTCGGGGCCACCAAAAATCAAGTGCGAGAAGTCATACGACACTAATTCCAGTGACGAATCTGGATCTTTTTCTGATGGCGATAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23029
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019017 Nonsense 390 727 3 6
Genomic Location (Zv9):
Chromosome 17 (position 15563568)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15714396
GRCz11 17 15722329
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGTGTCATCTTTTCCTCTCGAGGCCCCTACCATTTGGCGCCCACACATT[C/A]ATATCCTGATGAGAGTTGTTTGGGGCAGGAGACTCCAGAAGACCTGTGGG
Long Flanking Sequence:
CCTGGATCTCTCCAAGGTAAAAGCAGAACCAGTCAATGGGGAAGTCTCTGTGCCGTTAGACTTGTCTGAGTTGGAACAGAATGGTCCGGTCAGGGGTAAAGTAATTGAGATGGACATAGAAATGGAGTTTGATGGAAGGCAACTTAGTTCAACACCCAATGAATTCCCAGCAAGCAAACGATCACCGGTGTGCCTGCGCTCCCTTGTTAAAAAGGAAGTCTCATCTTCAGATCATTGTCTTTCCACTGACCTGCAGCTTTCCAGCAGAACTTCTCCACTTCGGGAACAACAGGTTGTCACAGTTCAGGAACAACAGGTTGACTTCCAAAAGGACTATCAGGCTTTTATTGGAGGACTCTCGTCAAAGAAATTACCCGATGGAGTGTCTCTCAAATCGCTTTCTCTTGAGAGGATTTGTTCACAAGATCCCGAACAAGAGAACGACAGAAAAAGTGTCATCTTTTCCTCTCGAGGCCCCTACCATTTGGCGCCCACACATT[C/A]ATATCCTGATGAGAGTTGTTTGGGGCAGGAGACTCCAGAAGACCTGTGGGCAGGATCCAGCCAGTCGTTTCCCTGCACCCAAACTCTGTCCCCAACTTCGTCCTCTCAAGATCCCTCTTTGCCCTATCGCCGGCACCCTAAGAGCAGTTGTCCGGTGCCCATTAAAATGTGTTCCCGCTCGACTCGTGCCGATAGCCATGTCAGAACCTCCAGCTCATGCTCTTCCTACTCGTATGCAGAGGACGGCAGTGGAGGCTCTCCTTCCAGCCTGCCCCAGTTCGAGCTCTCTACCTCTCCTTGTTCCACCATGGCGCGTTGTCTGGCCCTCGAACACCGGGAGCATAGCACGTCGGGGCCACCAAAAATCAAGTGCGAGAAGTCATACGACACTAATTCCAGTGACGAATCTGGATCTTTTTCTGATGGCGATAGCGAGTCGTTTGCCACCAAAGAGCGCACACAAGAGGTTAGTGTACACTGCTAAAACAGAAATGTGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11743
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019017 Nonsense 432 727 3 6
Genomic Location (Zv9):
Chromosome 17 (position 15563695)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15714523
GRCz11 17 15722456
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
WCCCAAACTCTGTCCCCAACTTCGTCCTCTCAAGATCCCTCTTTGCCCTA[T/A]CGCCGGCACCCTAAGAGCAGTTGTCCGGTGYCCAWTAAAATGTGTTCCCG
Long Flanking Sequence:
TTTGATGGAAGGCAACTTAGTTCAACACCCAATGAATTCCCAGCAAGCAAACGATCACCGGTGTGCCTGCGCTCCCTTGTTAAAAAGGAAGTCTCATCTTCAGATCATTGTCTTTCCACTGACCTGCAGCTTTCCAGCAGAACTTCTCCACTTCGGGAACAACAGGTTGTCACAGTTCAGGAACAACAGGTTGACTTCCAAAAGGACTATCAGGCTTTTATTGGAGGACTCTCGTCAAAGAAATTACCCGATGGAGTGTCTCTCAAATCGCTTTCTCTTGAGAGGATTTGTTCACAAGATCCCGAACAAGAGAACGACAGAAAAAGTGTCATCTTTTCCTCTCGAGGCCCCTACCATTTGGCGCCCACACATTCATATCCTGATGAGAGTTGTTTGGGGCAGGAGACTCCAGAAGACCTGTGGGCAGGATCCAGCCAGTCGTTTCCCTGCACCCAAACTCTGTCCCCAACTTCGTCCTCTCAAGATCCCTCTTTGCCCTA[T/A]CGCCGGCACCCTAAGAGCAGTTGTCCGGTGCCCATTAAAATGTGTTCCCGCTCGACTCGTGCCGATAGCCATGTCAGAACCTCCAGCTCATGCTCTTCCTACTCGTATGCAGAGGACGGCAGTGGAGGCTCTCCTTCCAGCCTGCCCCAGTTCGAGCTCTCTACCTCTCCTTGTTCCACCATGGCGCGTTGTCTGGCCCTCGAACACCGGGAGCATAGCACGTCGGGGCCACCAAAAATCAAGTGCGAGAAGTCATACGACACTAATTCCAGTGACGAATCTGGATCTTTTTCTGATGGCGATAGCGAGTCGTTTGCCACCAAAGAGCGCACACAAGAGGTTAGTGTACACTGCTAAAACAGAAATGTGTAAAATTTACAGTAAAAAACTGACTGCCGTGGTTTCCAAAATGTTACCTTTAATAATTCTGGGAACCACATATACCAGTTTTTTGTTTGTTTGTTTTTTTAACTGTTAATATTTAAGTATGAGAATCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28828
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019017 Essential Splice Site 467 727 3 6
Genomic Location (Zv9):
Chromosome 17 (position 15563800)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15714628
GRCz11 17 15722561
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTCGTGCCGATAGCCATGTCAGAACCTCCAGCTCATGCTCTTCCTACTC[G/T]TATGCAGAGGACGGCAGTGGAGGCTCTCCTTCCAGCCTGCCCCAGTTCGA
Long Flanking Sequence:
CATTGTCTTTCCACTGACCTGCAGCTTTCCAGCAGAACTTCTCCACTTCGGGAACAACAGGTTGTCACAGTTCAGGAACAACAGGTTGACTTCCAAAAGGACTATCAGGCTTTTATTGGAGGACTCTCGTCAAAGAAATTACCCGATGGAGTGTCTCTCAAATCGCTTTCTCTTGAGAGGATTTGTTCACAAGATCCCGAACAAGAGAACGACAGAAAAAGTGTCATCTTTTCCTCTCGAGGCCCCTACCATTTGGCGCCCACACATTCATATCCTGATGAGAGTTGTTTGGGGCAGGAGACTCCAGAAGACCTGTGGGCAGGATCCAGCCAGTCGTTTCCCTGCACCCAAACTCTGTCCCCAACTTCGTCCTCTCAAGATCCCTCTTTGCCCTATCGCCGGCACCCTAAGAGCAGTTGTCCGGTGCCCATTAAAATGTGTTCCCGCTCGACTCGTGCCGATAGCCATGTCAGAACCTCCAGCTCATGCTCTTCCTACTC[G/T]TATGCAGAGGACGGCAGTGGAGGCTCTCCTTCCAGCCTGCCCCAGTTCGAGCTCTCTACCTCTCCTTGTTCCACCATGGCGCGTTGTCTGGCCCTCGAACACCGGGAGCATAGCACGTCGGGGCCACCAAAAATCAAGTGCGAGAAGTCATACGACACTAATTCCAGTGACGAATCTGGATCTTTTTCTGATGGCGATAGCGAGTCGTTTGCCACCAAAGAGCGCACACAAGAGGTTAGTGTACACTGCTAAAACAGAAATGTGTAAAATTTACAGTAAAAAACTGACTGCCGTGGTTTCCAAAATGTTACCTTTAATAATTCTGGGAACCACATATACCAGTTTTTTGTTTGTTTGTTTTTTTAACTGTTAATATTTAAGTATGAGAATCAAAATGTACACAATTTACACAATTGGTTTTATTTCAAAGATTCACAGTAAACTACCATACTTTATTAGTTAATTTGATTGTTATACACTAGTCTTTTCAAGTATTAATA
Associated Phenotype:
Not determined