Busch Lab

ZMP

aanat1

Ensembl ID:
ENSDARG00000036567
ZFIN ID:
ZDB-GENE-040329-1
Description:
serotonin N-acetyltransferase [Source:RefSeq peptide;Acc:NP_956998]
Human Orthologue:
AANAT
Human Description:
aralkylamine N-acetyltransferase [Source:HGNC Symbol;Acc:19]
Mouse Orthologue:
Aanat
Mouse Description:
arylalkylamine N-acetyltransferase Gene [Source:MGI Symbol;Acc:MGI:1328365]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa33859 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26733
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053126 Essential Splice Site 103 204 2 3
ENSDART00000134559 Essential Splice Site 116 148 2 3
Genomic Location (Zv9):
Chromosome 6 (position 22267918)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 18520953
GRCz11 6 23618872
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTCGCTTTTATCATAGGATCTCTCTGGGACCAGGACCGTCTGACTGCT[G/A]TAATAATCTTCAAATATATACTTGTTATCGTTAGTAACATAGGTTAATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33859
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053126 Nonsense 110 204 3 3
ENSDART00000134559 Nonsense 123 148 3 3
Genomic Location (Zv9):
Chromosome 6 (position 22267127)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 18520162
GRCz11 6 23618081
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATTTTACTATTTAATTTTGTCTCTTTTTAGGATGCACTGACCCTTCAT[A/T]AACCTCATGGAACTACTGTTCACATCCATGTGCTGGCAGTCCATCGGACC
Associated Phenotype:
Not determined