Busch Lab

ZMP

col18a1

Ensembl ID:
ENSDARG00000036558
ZFIN ID:
ZDB-GENE-030516-3
Description:
Collagen type XVIII alpha 1 [Source:UniProtKB/TrEMBL;Acc:B0S8G3]
Human Orthologue:
COL18A1
Human Description:
collagen, type XVIII, alpha 1 [Source:HGNC Symbol;Acc:2195]
Mouse Orthologue:
Col18a1
Mouse Description:
collagen, type XVIII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88451]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa34722 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3739
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007058 Nonsense 25 1383 1 41
ENSDART00000053118 Nonsense 25 1385 1 42
ENSDART00000097295 None None 1349 None 42
ENSDART00000130434 Nonsense 25 1645 1 41
Genomic Location (Zv9):
Chromosome 9 (position 42987575)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 42112745
GRCz11 9 41914532
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTGTGCCTCTTTATTTTGGCATGCGTGAGGATACGCCACACACATGGCT[G/A]GTTCTGGTTTGATGAYTCCAAGGAARTTGAGAAGGGYGTGCAGACACCAG
Long Flanking Sequence:
ATCCTGCATTGAAGAGTTGTTTTGAGTACTTGAGCAGCTTGTTTCTGTGCAACAGGGGATTCATGTTAACTGTGGAATTTGCGCGCCCCTATATAAAGGCTGTAAAAGTAAGTTGAAACAACTCTTAATTCCATCAGCGAGGGCATTTAGAAGCACCGGCGTACACAAAAGGGCGCCTTGCAGGCATTTTTGGTAAGAATATCTATCAGCAGAGACACTCTTTCACATGGACAAAGGGGAGATGGAGCTTACGGGGGTTGAAAAAGGTCCCAAGCCTGGCCAATGACGAAGCAGCCCCCCGCTCTCTCTTTTAAATATGTTACTCCTCCTCTAAACTTTTCCCTGCCTGGCTTGTGGGCTGATTGTGGTGACTTTACGGTGAGCCAGGGACGAGTCTGTCTGTACTCCTGAATGACTGCAAGTGAACATGATGGCTGAACTCAGGTTTTGGCTGTGCCTCTTTATTTTGGCATGCGTGAGGATACGCCACACACATGGCT[G/A]GTTCTGGTTTGATGACTCCAAGGAAATTGAGAAGGGCGTGCAGACACCAGCATACCTGACCACCGTAGGGCCCACATCCCTGCCGAGGACAGAACCATCCAGAACAACAGGTACAAGTGCTTCTGTAACTGAAGAGGTCGCGAAAGAGGTCAGTTTTGAAGGGGAACCGGAGGTCAGATCCAGGTCTGGATTGGGGATTGAGTCCGGATCCGGATCTGGATCATCCAGTTTTGAAAGACAGCATGAATATTTAACATCATCCGACAAAATTTGGGGTATTATTGATGACAATTCTAGTTTGCATAATCAAGTGACCAAAGTGGACCAGACGGATGGACTTGACCCAGCAAACAGTCGATTTAATGAAGGCGTTAATGTTTCTTTCACAAATATTACTGCTAAAAATAATGTAAATGAGAGTAATTTTGCAGAGCATGCTAACACGACGTTGTATTCCTCTGAATACGCTGTCTCAGATAATGCACTAACCATTGAAAGCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18963
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007058 Nonsense 797 1383 25 41
ENSDART00000053118 Nonsense 798 1385 25 42
ENSDART00000097295 Nonsense 763 1349 26 42
ENSDART00000130434 Nonsense 1059 1645 25 41
Genomic Location (Zv9):
Chromosome 9 (position 43041705)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 42166875
GRCz11 9 41968662
KASP Assay ID:
2260-2280.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAAACAAACTTGTTTACAGGGGGAGAAAGGAGAACCTGGACTTATTCTT[G/T]GACCTGATGGAAATCCACTTTACCTTGGTGGATTGACAGGACAGAAGGTT
Long Flanking Sequence:
CAAATATTTATAGTTTGCACAGCTATATAATTTTTTGATTTTAATAAATAAATGTTTGTTGGAATATCACAAATTTTCAGTCACATATATTCTGCAAATGACAGTATTTTATTTAAATTTTCTTAGAACTGTTTATTTTGTTTTTTATTAAAACCCATACCTGCAAATTCAGATAAATCTAGTCAAACCTAATTTGATCCATATCTTTGGTCAAGAGGGCATTTATAGGTATTTTAAAACAGCTTATCCAATAAAAAATACTATATAAAGTCAGAATGTTGTATTTTAGAATCAGTCTTATACTCTTGCTTTTTATTTCATCAGGGCCCAATGGGACCAAAGGGTGACAGAGGTGAGCCTGGTCTTCCAGGCTATGACATTAAGGTTTGTATGCCGAAACCAACAAACAAAGCTTAACATGAGATGTTATAAACCTCTGCTCTGAAAAAAACAAACAAACTTGTTTACAGGGGGAGAAAGGAGAACCTGGACTTATTCTT[G/T]GACCTGATGGAAATCCACTTTACCTTGGTGGATTGACAGGACAGAAGGTTGGTTTATTCATTCAAAAGACTTGTTTTTGGTCTCTAAATAATACAGATTAGTCCTTTTTTGTCTCTATTGTTGTCATAACTTCACTAGCAATAATAAGTAGGTAAATATTATATCAATGTACTTTTTTATTTAGCTAAATTTGATGTTCTTTTTATTTTACTTTCTGTAGGGTGAGAGAGGTATTTCTGGACCAGTCGGACCTCCTGTATGTTTCTATTTTTATTTATTTTTATTATTCAGATTTAAATAAAGAACTATTTTAGATGCATCCGCTAACATCTAAGTTTGATCTCATTTTTTTCAGGGTCCAGCAGGACCTCCTGGTGCAAAAGGTGAATTCGGAATGCCAGGCAGACCTGTAAGTCTTTCACAAAACAACTTTCATTAACCTACAACTATTGTATGGCATCATATTTAAGTGAGTATGTAATTCGATTTTACTTAACAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34722
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007058 Essential Splice Site 842 1383 27 41
ENSDART00000053118 Essential Splice Site 843 1385 27 42
ENSDART00000097295 Essential Splice Site 808 1349 28 42
ENSDART00000130434 Essential Splice Site 1104 1645 27 41
Genomic Location (Zv9):
Chromosome 9 (position 43042116)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 42167286
GRCz11 9 41969073
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCAGGACCTCCTGGTGCAAAAGGTGAATTCGGAATGCCAGGCAGACCTG[T/A]AAGTCTTTCACAAAACAACTTTCATTAACCTACAACTATTGTATGGCATC
Long Flanking Sequence:
GCTTAACATGAGATGTTATAAACCTCTGCTCTGAAAAAAACAAACAAACTTGTTTACAGGGGGAGAAAGGAGAACCTGGACTTATTCTTGGACCTGATGGAAATCCACTTTACCTTGGTGGATTGACAGGACAGAAGGTTGGTTTATTCATTCAAAAGACTTGTTTTTGGTCTCTAAATAATACAGATTAGTCCTTTTTTGTCTCTATTGTTGTCATAACTTCACTAGCAATAATAAGTAGGTAAATATTATATCAATGTACTTTTTTATTTAGCTAAATTTGATGTTCTTTTTATTTTACTTTCTGTAGGGTGAGAGAGGTATTTCTGGACCAGTCGGACCTCCTGTATGTTTCTATTTTTATTTATTTTTATTATTCAGATTTAAATAAAGAACTATTTTAGATGCATCCGCTAACATCTAAGTTTGATCTCATTTTTTTCAGGGTCCAGCAGGACCTCCTGGTGCAAAAGGTGAATTCGGAATGCCAGGCAGACCTG[T/A]AAGTCTTTCACAAAACAACTTTCATTAACCTACAACTATTGTATGGCATCATATTTAAGTGAGTATGTAATTCGATTTTACTTAACAACCTGATTTTATGACTGTAGGGTCGTCCAGGTGTGAACGGATATAAAGGAGAGAAGGGAGAGCCAAGTTCAGGCTCTGGATATGGTTACCCGGTAAGTCCACCACCTCCTCTTGAATATGAAAATTAATGCAGTTCGTTCAATCAGTGCTTGTTATATAGATGGCTTGCCCTCATATGTTATCTTGTGGCTTTTCAAGGGTCCCCCTGGTCCCCCAGGACCCCCTGGTCCCCCCGGACCCGCTGTGCCCTTGGACAGATTTGGCGTAAGTGATTTTTGTGTCATATAAGCTGTAATTCATGCATGAAATGCTGGAAAATGAGCTCAATATGCTGGCTGTGTTAAACTGAAGTGATCATGATTGCACCAGCAATAATTTGCAACCTCATTTTTTTCCCATTTCAGAGATATGAA
Associated Phenotype:
Not determined