Busch Lab

ZMP

agpat3

Ensembl ID:
ENSDARG00000036549
ZFIN ID:
ZDB-GENE-040426-2765
Description:
1-acyl-sn-glycerol-3-phosphate acyltransferase gamma [Source:RefSeq peptide;Acc:NP_998590]
Human Orthologue:
AGPAT3
Human Description:
1-acylglycerol-3-phosphate O-acyltransferase 3 [Source:HGNC Symbol;Acc:326]
Mouse Orthologue:
Agpat3
Mouse Description:
1-acylglycerol-3-phosphate O-acyltransferase 3 Gene [Source:MGI Symbol;Acc:MGI:1336186]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa9087 Nonsense Mutation detected in F1 DNA Not yet available
sa19560 Nonsense Available for shipment Available now
sa39676 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa32749 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa9087
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115081 Nonsense 68 377 4 10
ENSDART00000135795 Nonsense 68 116 4 4
ENSDART00000145167 Nonsense 68 221 4 6
Genomic Location (Zv9):
Chromosome 1 (position 47351328)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46162989
GRCz11 1 46854221
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTWCTCTCTTTTATCTTTATATTAGAGTTAGTGATGTTGTTGGAGTGGTG[G/A]TCTGGCACTGAGTGCACGCTGTAYACCGATCAGGCMACGGTGGATAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19560
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115081 Nonsense 109 377 4 10
ENSDART00000135795 Nonsense 109 116 4 4
ENSDART00000145167 Nonsense 109 221 4 6
Genomic Location (Zv9):
Chromosome 1 (position 47351205)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46162866
GRCz11 1 46854098
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCCTCAACCACAACTTCGAGGTGGACTTTCTGTGTGGCTGGACCATCTG[T/A]GAGAGATACGGCGTGCTGGGGGTGAGTCCCGATGAGCAGTGAAGAGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39676
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115081 Essential Splice Site 222 377 None 10
ENSDART00000135795 None None 116 None 4
ENSDART00000145167 None 222 221 None 6
Genomic Location (Zv9):
Chromosome 1 (position 47345649)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46157310
GRCz11 1 46848542
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCCGCACCAAAGGATTCACCACCACACTGCAATGCCTAAAGGGAACAGG[T/G]CAGACAAACACTTGTGCACACACCCCGTCATTGTCACACACAGTTTACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32749
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115081 Nonsense 253 377 7 10
ENSDART00000135795 None None 116 None 4
ENSDART00000145167 None None 221 None 6
Genomic Location (Zv9):
Chromosome 1 (position 47340303)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46151964
GRCz11 1 46843196
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACCCGACTCTGTTGGGGATTGTCAATGGGAAGAAGTACAAAGCAGACT[T/A]GAGTGTCAGGTGAGTCTCCCAGTTCACTGATATCACTGTATATAATAAAT
Associated Phenotype:
Not determined