Busch Lab

ZMP

si:ch211-187d7.3

Ensembl ID:
ENSDARG00000036462
ZFIN ID:
ZDB-GENE-091204-322
Description:
LOC402861 protein [Source:UniProtKB/TrEMBL;Acc:Q6PFJ8]
Human Orthologue:
RAB11FIP1
Human Description:
RAB11 family interacting protein 1 (class I) [Source:HGNC Symbol;Acc:30265]
Mouse Orthologue:
Rab11fip1
Mouse Description:
RAB11 family interacting protein 1 (class I) Gene [Source:MGI Symbol;Acc:MGI:1923017]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa41731 Nonsense Mutation detected in F1 DNA Not yet available
sa21811 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa41731
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052971 Nonsense 249 652 2 5
ENSDART00000128156 None None 116 None 1
Genomic Location (Zv9):
Chromosome 10 (position 42686640)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 41400194
GRCz11 10 41322074
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCCAAAAAGAAGAACAAGCTCAAGTCTTTATTTGTACCCAAGTCTGGTT[T/A]GCAACGTAACATGTCGCAGTCCATGTCCACCCTCCCCACGCTGCCTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21811
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052971 Essential Splice Site 492 652 3 5
ENSDART00000128156 None None 116 None 1
Genomic Location (Zv9):
Chromosome 10 (position 42682140)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 41395694
GRCz11 10 41317574
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAGGAAGAAGCTAGAGGAAGAGGAGAGGAAAAGAGTTGCGAGAGAGGAG[G/A]AAAGAAAGAGGGAAGAGGAAAAGAGACGAGAGGAAGAGAAGAGGAAGAAG
Associated Phenotype:
Not determined