Busch Lab

ZMP

zgc:113025

Ensembl ID:
ENSDARG00000036445
ZFIN ID:
ZDB-GENE-050417-12
Description:
hypothetical protein LOC554550 [Source:RefSeq peptide;Acc:NP_001017564]
Human Orthologue:
SERPINH1
Human Description:
serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)
Mouse Orthologue:
Serpinh1
Mouse Description:
serine (or cysteine) peptidase inhibitor, clade H, member 1 Gene [Source:MGI Symbol;Acc:MGI:88283]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa12866 Nonsense Available for shipment Available now
sa654 Nonsense F2 line generated Not yet available
sa34047 Nonsense Available for shipment Available now
sa16240 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12866
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052942 Nonsense 74 414 2 5
ENSDART00000127009 Nonsense 74 414 1 4
Genomic Location (Zv9):
Chromosome 7 (position 22443858)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21009043
GRCz11 7 21275381
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGGTTCCCAGACCAACACCYTCATCYCCCCGCTTCTGTTGGCCAACTCCT[T/A]GCTGGCTCTAGGGGGTGGAGCRAAAGGATCCACAGYYAGCCAGTTTCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa654
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052942 Nonsense 110 414 2 5
ENSDART00000127009 Nonsense 110 414 1 4
Genomic Location (Zv9):
Chromosome 7 (position 22443965)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21009150
GRCz11 7 21275488
KASP Assay ID:
554-0562.1 (used for ordering genotyping assays)
KASP Sequence:
TGAGGATCACCAAAAATGAGAATGTGGTAGGAGAGACTTTGACCACAGCA[C/T]AGAAGGCTGTGCATGAATCAAATGGGACCAGCTACATATTGCACAGTTCC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa34047
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052942 Nonsense 216 414 3 5
ENSDART00000127009 Nonsense 216 414 2 4
Genomic Location (Zv9):
Chromosome 7 (position 22458051)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21023236
GRCz11 7 21289574
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGATCTTTTTGTTTCAGGATTGTGGGATCGAGGCTTTTACCATGAAAAC[C/T]AAGATGTGCGCAGCTTCCTAGGAACCAAATACACTAAAGTTCCCATGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16240
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052942 Nonsense 241 414 4 5
ENSDART00000127009 Nonsense 241 414 3 4
Genomic Location (Zv9):
Chromosome 7 (position 22459925)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21025110
GRCz11 7 21291448
KASP Assay ID:
2259-8697.1 (used for ordering genotyping assays)
KASP Sequence:
CYAAGACTCCCYATGCTAAATGCTTGTATCCTAGGTGTGTACCGTCATTA[C/A]GAGGACATGGAGAACATGGTGCAGGTTTTGGAACTAGGCCTGTGGGAAGG
Associated Phenotype:
Not determined