Busch Lab

ZMP

ndufv1

Ensembl ID:
ENSDARG00000036438
ZFIN ID:
ZDB-GENE-040808-73
Description:
NADH dehydrogenase [Source:RefSeq peptide;Acc:NP_001003747]
Human Orthologue:
NDUFV1
Human Description:
NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa [Source:HGNC Symbol;Acc:7716]
Mouse Orthologue:
Ndufv1
Mouse Description:
NADH dehydrogenase (ubiquinone) flavoprotein 1 Gene [Source:MGI Symbol;Acc:MGI:107851]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa43227 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4787
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052930 Nonsense 3 492 2 11

The following transcripts of ENSDARG00000036438 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 9838639)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9297178
GRCz11 19 9216103
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATATTGCTCACTGTTCTGTTTCATCCATGTCTTCCAGATAAGGATGTTGT[C/A]GTGTCTCGGCTCTCCAGCTCTTAGCCGGGTTCTGAGCAGCGGGGCGTCTC
Long Flanking Sequence:
TGCAGTTAGCTGATCTTCGGGTCTAACAAGGGCACTTTCAGCTTAGCTTAGCTTATCTTAGCATAAAACACTGAATCATATTAGACCATTAGCATCTTGCTCAAAAAAAAACAAAACAAACAAAAAACAAAACAAAACAAATCTATGCTATTTAAAGCTTGACTCTACTGTAGTGACGTGTAACAGAAAATGTAACAAAGTCAGACAGAAAATGAAAAGTTTCGTTTTTTTCTAGGCTCATGTGTCTCTGACTCTACTTTTTTTCTGGCGTAATATTGAGGATATTTCCTGCTGTACCATGGCTGCAGCAGGTGCAATGATGTTACGCAGCACTGTTGCCTAGTAGTTACCTTGCTGGGCATTATATTCAGGTGTTGTGTAATATTGTTGTGCCTGCTGCAGCCATGGTACAGCAGCAAAGCTTCTTGATTATAACGCCAAACTGACAGTATATTGCTCACTGTTCTGTTTCATCCATGTCTTCCAGATAAGGATGTTGT[C/A]GTGTCTCGGCTCTCCAGCTCTTAGCCGGGTTCTGAGCAGCGGGGCGTCTCGTGCTCCTGTGGCAGTGGCTGTAGCTGGAGCCTCTCGCACCTCTGTGTCCTCCAACTCTGCTCCACAATGCAGGACTCTGCTCCGCTACAGCAGCACAGCTCAACAGGTGAAGCACTCTCATCCACTCGCTGGATTACTGATCATCAGTGCACAGCTATAATCAGTGTGTGTGTTTGTGTGTGTGTCATGTAGGAAACACCCAAGAAGACCAAGTTTGGGCCTCTTGCTGACCAGGACAGAATATTCACTAACCTGTATGGACGCCATGACTGGAGGTAGAATATGTTATACTGTATTATGAATTGTATGTAGAACTGAGGGCTTTTTAAAGTTCTATATTTGGGTTTTTTCTAATTCTTTTAAACATTAGATAAATTATAGACTCTTCTCTTTTTCTAGATGGTGTCTACAAGATTTATTTATATAAATGAGTGACTTATGTGGTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43227
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052930 Essential Splice Site 336 492 None 11

The following transcripts of ENSDARG00000036438 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 9845515)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9304054
GRCz11 19 9222979
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAGAAGAGATGTCCATTCCCCTTAAAGAGCTTATCGAAAGACATGCAGG[T/C]ACACCTCAGGCCAGCCGCTAGTGGTATACCACCTATAGGATACACCCCTT
Long Flanking Sequence:
GCACTATAGTGGAAATATCCGACATTGCAATATTTTGTTTTTCTGCGATTTTATATATTGCGATACAAATATAATTCCACCAGATTAGTTGAATAGCTCTATTTAGAAACATTTTATTCAATTAGATAGGTTGGGATGATCAAGACTTTTTCTGTGCAGTGTGATTGCATAAATTCTAATAAATTACAAACCTATATAAATACAACACAGCAAAGATAAACGTTATTAGATAAAAGTGTATTTTATTTATTAGATTAGTTATTAATATGACATGTTCTTGTTGCAGGCGTGTTTGGCTGTCCCACGACTGTTGCTAATGTTGAGACCGTAGCGGTGGCACCAACCATCTGCCGTCGCGGTGGCACATGGTTTGCAGGTTTCGGCCGAGAAAGAAACTCCGGCACCAAGCTCTTCAACATTTCAGGCCACGTTAACAACCCCTGTACAGTGGAAGAAGAGATGTCCATTCCCCTTAAAGAGCTTATCGAAAGACATGCAGG[T/C]ACACCTCAGGCCAGCCGCTAGTGGTATACCACCTATAGGATACACCCCTTCCTCTCTTATGCACTTTGTTAAAAAAACACTTCTAAAGTTTTCTAAAGTTAGCTTTTATTTTAAACTGCATAACTTTTATTTCTACATAATTTAGATTGTTATTATTATTTTTGTTATTATGTTTAAGGTCTCGAGTGGTTGTGTAAGCATTTCACTGCATATCATACTGTGTATGTGACAAATCAAATATGAATTTGACATGGAAATGGTTATTCCTGAGGTGATTATGGAGCCATAACTGATGGTTTTCCTGTAGGTGGTGTCCGGGGTGGTTGGGATAATCTCCTGTGTGTCATTCCTGGAGGATCGTCCACACCACTCATCCCACAACACGTGTGTGACACCGTTCTCATGGATTTCGATGCCCTCATTCAGGCTCAGACTGGTCTCGGCACTGCAGCACTTATTGTCATGGATAAATCAGTGAGTTCATTTGTAAAATAACACAC
Associated Phenotype:
Not determined