Busch Lab

ZMP

slc3a2

Ensembl ID:
ENSDARG00000036427
ZFIN ID:
ZDB-GENE-000831-3
Description:
solute carrier family 3, member 2 [Source:RefSeq peptide;Acc:NP_571676]
Human Orthologue:
SLC3A2
Human Description:
solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 [Source:H
Mouse Orthologue:
Slc3a2
Mouse Description:
solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 Gene [Sou

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa20908 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20908
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052917 Nonsense 105 485 3 9
ENSDART00000112833 Nonsense 104 484 5 11

The following transcripts of ENSDARG00000036427 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 21682362)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20272798
GRCz11 7 20524766
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTAATCATAGTACAAGCTCCACGCTGTAAACCCATTCCTGAAATGCACTG[G/A]TGGAATGAAGGTCCTCTGTACCAGATATCAAACTTGGATGCCTTCTCTAA
Associated Phenotype:
Not determined