Busch Lab

ZMP

LOC100007362

Ensembl ID:
ENSDARG00000036424
Human Orthologue:
PCDH20
Human Description:
protocadherin 20 [Source:HGNC Symbol;Acc:14257]
Mouse Orthologue:
Pcdh20
Mouse Description:
protocadherin 20 Gene [Source:MGI Symbol;Acc:MGI:2443376]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa35160 Nonsense Mutation detected in F1 DNA Not yet available
sa35159 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa35160
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052912 Nonsense 316 881 2 2
Genomic Location (Zv9):
Chromosome 11 (position 43998181)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 42624696
GRCz11 11 42916777
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACGGGTCAGCCAGGAAAGCAAAAGCTTATTTCACTTGGATACAACGACT[G/T]GAGTTCTGAAACTAGCAGGAAAGATCAACAACAACAGTGCGAAGCTATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35159
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052912 Nonsense 740 881 2 2
Genomic Location (Zv9):
Chromosome 11 (position 43996909)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 42623424
GRCz11 11 42915505
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAAGAGAACTGACGGAGAACCAGGGTCGTTTGACATCGATCCGTACACT[G/T]GAAACATCACCCTGAGGAAAGCCTTGAACAGTCGGGGGCTTTATAGTTTA
Associated Phenotype:
Not determined