Busch Lab

ZMP

glb1

Ensembl ID:
ENSDARG00000036415
ZFIN ID:
ZDB-GENE-050410-9
Description:
beta-galactosidase [Source:RefSeq peptide;Acc:NP_001017547]
Human Orthologue:
GLB1
Human Description:
galactosidase, beta 1 [Source:HGNC Symbol;Acc:4298]
Mouse Orthologue:
Glb1
Mouse Description:
galactosidase, beta 1 Gene [Source:MGI Symbol;Acc:MGI:88151]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa8423 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa24857 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa11023 Nonsense Available for shipment Available now
sa18711 Nonsense Mutation detected in F1 DNA Not yet available
sa19602 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25676
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033761 None None 651 None 17
ENSDART00000124682 Nonsense 12 676 1 16
ENSDART00000136942 None None 651 None 16
Genomic Location (Zv9):
Chromosome 1 (position 52956766)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 51827365
GRCz11 1 52462103
KASP Assay ID:
2259-1153.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACTCGACTCTAAAGAATGATTCTTAGCTTTAGCAGCAACCAAAACAAAT[G/A]GCATTTGACTTCCGCACCGCTGTTTACCGTTTCAAACACCATGACTCCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8423
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033761 Essential Splice Site 126 651 3 17
ENSDART00000124682 Essential Splice Site 151 676 3 16
ENSDART00000136942 Essential Splice Site 126 651 3 16
Genomic Location (Zv9):
Chromosome 1 (position 52960118)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 51830717
GRCz11 1 52465455
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCTGGTYATCATGAGACCAGGACCCTACATATGTGCCGAGTGGGATATG[G/A]TGAGAAAACACTGTACTTTCTATAGGCAGRGAATRTATGTTAGGATAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24857
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033761 Essential Splice Site 126 651 3 17
ENSDART00000124682 Essential Splice Site 151 676 3 16
ENSDART00000136942 Essential Splice Site 126 651 3 16
Genomic Location (Zv9):
Chromosome 1 (position 52960119)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 51830718
GRCz11 1 52465456
KASP Assay ID:
554-7376.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGGTCATCATGAGACCAGGACCCTACATATGTGCCGAGTGGGATATGG[T/G]GAGAAAACACTGTACTTTCTATAGGCAGAGAATATATGTTAGGATAGGGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3363
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033761 Nonsense 204 651 6 17
ENSDART00000124682 Nonsense 229 676 6 16
ENSDART00000136942 Nonsense 204 651 6 16
Genomic Location (Zv9):
Chromosome 1 (position 52962349)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 51832948
GRCz11 1 52467686
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCCTGTGATTTTAACTACATGCGTCATCTGAGCCAGTTGTTCCGGTTTTA[T/A]CTCGGGGAAGAGGCTGTGCTGTTCACTACTGATGGGGCAGGTCTGGGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11023
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033761 Nonsense 325 651 10 17
ENSDART00000124682 Nonsense 350 676 10 16
ENSDART00000136942 Nonsense 325 651 10 16
ENSDART00000033761 Nonsense 325 651 10 17
ENSDART00000124682 Nonsense 350 676 10 16
ENSDART00000136942 Nonsense 325 651 10 16
Genomic Location (Zv9):
Chromosome 1 (position 52964743)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 51835342
GRCz11 1 52470080
KASP Assay ID:
2259-1156.1 (used for ordering genotyping assays)
KASP Sequence:
TACCACATTATAGGTGCCAACACTCCTTATGGTCCTCAACCCACCAGCTA[T/G]GACTATGACTCTCCTCTTACAGAGGCTGGAGATCTCACWGAGAAATATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18711
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033761 Nonsense 325 651 10 17
ENSDART00000124682 Nonsense 350 676 10 16
ENSDART00000136942 Nonsense 325 651 10 16
ENSDART00000033761 Nonsense 325 651 10 17
ENSDART00000124682 Nonsense 350 676 10 16
ENSDART00000136942 Nonsense 325 651 10 16
Genomic Location (Zv9):
Chromosome 1 (position 52964743)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 51835342
GRCz11 1 52470080
KASP Assay ID:
2259-1156.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACCACATTATAGGTGCCAACACTCCTTATGGTCCTCAACCCACCAGCTA[T/G]GACTATGACTCTCCTCTTACAGAGGCTGGAGATCTCACTGAGAAATATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19602
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033761 Nonsense 648 651 16 17
ENSDART00000124682 Nonsense 673 676 16 16
ENSDART00000136942 Nonsense 648 651 16 16
Genomic Location (Zv9):
Chromosome 1 (position 52973106)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 51843705
GRCz11 1 52478443
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTAAACGGCACCGTGAACGGCCAATACAAGAGACAACTATTCAACAAA[C/T]AAGACCTCTTTTGAGTTTACAGCCGCTTCCAGTTGCAGAAATTGTTTATA
Associated Phenotype:
Not determined