Busch Lab

ZMP

nucb2b

Ensembl ID:
ENSDARG00000036291
ZFIN ID:
ZDB-GENE-030131-4775
Description:
nucleobindin 2b [Source:RefSeq peptide;Acc:NP_958887]
Human Orthologue:
NUCB2
Human Description:
nucleobindin 2 [Source:HGNC Symbol;Acc:8044]
Mouse Orthologue:
Nucb2
Mouse Description:
nucleobindin 2 Gene [Source:MGI Symbol;Acc:MGI:1858179]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa23350 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23350
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052703 Nonsense 50 430 3 13

The following transcripts of ENSDARG00000036291 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 36631334)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 38213037
GRCz11 18 38194045
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACTTCAGTAAATCTAATTTGACCTTCAGGACACCGGCTTGCACTATGAT[C/T]GATATCTCAGAGAGGTTATCGATTTCCTGGAAAAGGACCCGCATTTCAGA
Associated Phenotype:
Not determined