Busch Lab

ZMP

rnaset2

Ensembl ID:
ENSDARG00000036282
ZFIN IDs:
ZDB-GENE-030131-2513, ZDB-GENE-030131-2513
Description:
ribonuclease T2 [Source:RefSeq peptide;Acc:NP_001025235]
Human Orthologues:
RNASET2, RP11-514O12.4
Human Description:
ribonuclease T2 [Source:HGNC Symbol;Acc:21686]
Mouse Orthologues:
Rnaset2a, Rnaset2b
Mouse Descriptions:
ribonuclease T2A Gene [Source:MGI Symbol;Acc:MGI:1915445]
ribonuclease T2B Gene [Source:MGI Symbol;Acc:MGI:3702087]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa138
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126780 Nonsense 103 240 6 9
ENSDART00000128675 Nonsense 103 240 7 10
Genomic Location (Zv9):
Chromosome 13 (position 9531537)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 9739984
GRCz11 13 7051456
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTATGTGTAGCCCTAGTTTTTTATTGTGTGCGTTTGTGCTTAGGAATTAT[G/T]AATGGACGAAACACGGGACCTGTGCTGCAAAATCAGAGTCTTTAAACAGT
Associated Phenotype:
Not determined