Busch Lab

ZMP

smarcc1b

Ensembl ID:
ENSDARG00000036251
ZFIN ID:
ZDB-GENE-060503-273
Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1b
Human Orthologue:
SMARCC1
Human Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 [S
Mouse Orthologue:
Smarcc1
Mouse Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 Ge

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa25090 Essential Splice Site, Splice Site Mutation detected in F1 DNA Not yet available
sa1718 Nonsense Available for shipment Available now
sa23497 Essential Splice Site Available for shipment Available now
sa17040 Nonsense Available for shipment Available now
sa14091 Nonsense Available for shipment Available now
sa29186 Nonsense Available for shipment Available now
sa43257 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa25090
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site, Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085619 Essential Splice Site 130 961 4 29
ENSDART00000104385 Splice Site None 959 None 27
ENSDART00000130233 Splice Site None 322 None 11
ENSDART00000133978 None None 410 None 10
Genomic Location (Zv9):
Chromosome 19 (position 18956861)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 19802062
GRCz11 19 19375015
KASP Assay ID:
554-7692.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATGATGTCTCTTTTATCTCATACTCTGTGTATGTGTGTTTTTTTTTTTT[A/T]AAGGAGGCGCTTCGATCTGCAGAATCCATCCAGACTGGATCGCAATACAG
Long Flanking Sequence:
TAACTTCTTATGGCGGTCCAAAAACTTGTATACCCAAATGTATATGTTATAGGGGAAAAAATGTTTTTTTAATTGTTAAATTTAATTGTATTATCTTTCAATTTCTAAATAAGTTTTTTGACTAAAATATTATTTTATTAAATATATCTATTTAATAAATCTGTTCTGTGTAAATGCACCAAAATACATTGCCTATATTCACCGAGAAATGGATCAAAATATTCATTTTTAAAATAGGATGTACTCAATTGTGCCGAGCACTGTATCTGAAATGTTAAACTTTTGTAAGGGTGTCTTTGCTTTCACCTTTGATTTTAAGTTAATGCATGCAATAGTATATGTGAATGTTTTTACATTTGATATTAAGATATTAATGTCAGTTTTACAGAGATGCAATATTTTGGTCAACACACTAGCCCTCACTAATAATAAATTTAAGCTTTCAATAAATATGATGTCTCTTTTATCTCATACTCTGTGTATGTGTGTTTTTTTTTTTT[A/T]AAGGAGGCGCTTCGATCTGCAGAATCCATCCAGACTGGATCGCAATACAGAGATGCTGGGCTGTGTGGAGAAAACGCTGATGCAGGTATTTGTGTTTGGATCTTTAGCTAAGACAAACATCATGAGCAAATCTGTGTGTGGTGCAGTATCTGACATTTGTCTTCTGTGTTTGTGTTAGAATAACTTATTAAGCAGACCTGTGGTGTACCTTTCCCCGGATCTGGAACAAAAGCAAACTTCTAAACTTAAAGACATCATCCTGCGACACAATGTAAGTAAAAAATAAAATAAAAAAAATACTGACTAGACAGTAGTGATGGGTATTTAGAGATATTTTAATTTAAGTTACATGTACTAGTTAAAAGAATCGTAATATTTAGCAATAGGTGTGACATTTTATATTAGATTTTAATTATTTCAAAAATCTAATATAAGTTCAAATATCCCCTTAAAAGTTATATTGTTTATTAAAAGTTACTTAAAAGTTATTATTGTTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1718
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085619 Nonsense 186 961 5 29
ENSDART00000104385 Nonsense 184 959 5 27
ENSDART00000130233 Nonsense 184 322 5 11
ENSDART00000133978 None None 410 None 10
Genomic Location (Zv9):
Chromosome 19 (position 18956598)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 19801799
GRCz11 19 19374752
KASP Assay ID:
554-1664.1 (used for ordering genotyping assays)
KASP Sequence:
CCCCGGATCTGGAACAAAAGCAAACTTCTAAACTTAAAGACATCATCCTG[C/T]GACACAATGWAAGTAAAAAATAAAATAAAAAAAATACTGACTAGACAGTA
Long Flanking Sequence:
TATCTGAAATGTTAAACTTTTGTAAGGGTGTCTTTGCTTTCACCTTTGATTTTAAGTTAATGCATGCAATAGTATATGTGAATGTTTTTACATTTGATATTAAGATATTAATGTCAGTTTTACAGAGATGCAATATTTTGGTCAACACACTAGCCCTCACTAATAATAAATTTAAGCTTTCAATAAATATGATGTCTCTTTTATCTCATACTCTGTGTATGTGTGTTTTTTTTTTTTAAAGGAGGCGCTTCGATCTGCAGAATCCATCCAGACTGGATCGCAATACAGAGATGCTGGGCTGTGTGGAGAAAACGCTGATGCAGGTATTTGTGTTTGGATCTTTAGCTAAGACAAACATCATGAGCAAATCTGTGTGTGGTGCAGTATCTGACATTTGTCTTCTGTGTTTGTGTTAGAATAACTTATTAAGCAGACCTGTGGTGTACCTTTCCCCGGATCTGGAACAAAAGCAAACTTCTAAACTTAAAGACATCATCCTG[C/T]GACACAATGTAAGTAAAAAATAAAATAAAAAAAATACTGACTAGACAGTAGTGATGGGTATTTAGAGATATTTTAATTTAAGTTACATGTACTAGTTAAAAGAATCGTAATATTTAGCAATAGGTGTGACATTTTATATTAGATTTTAATTATTTCAAAAATCTAATATAAGTTCAAATATCCCCTTAAAAGTTATATTGTTTATTAAAAGTTACTTAAAAGTTATTATTGTTTATTTTGTATTATTACAATTACTGGCCACTTTATTTGGTACACCTTACTTGTACCCGGTTAGACCCCCTTCAGAACTGCTTTCATCCATTGTGGCATAGATTCAGCAAGGTACTGAAAATATTCCTCAGAGATTTTGGTCCATATTGACATGAGGGCATCATGCAGTTGCTGGAGATTTGACAGCTGCACACCCATGATGCAAATCTCCCATTCCACCACATCTCAATCTAATAGAGCACCTTTGGAATCTGGTGAAAATGGGGGCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1181
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085619 Essential Splice Site 188 961 5 29
ENSDART00000104385 Essential Splice Site 186 959 5 27
ENSDART00000130233 Essential Splice Site 186 322 5 11
ENSDART00000133978 None None 410 None 10
Genomic Location (Zv9):
Chromosome 19 (position 18956588)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 19801789
GRCz11 19 19374742
KASP Assay ID:
554-1091.1 (used for ordering genotyping assays)
KASP Sequence:
GGAACAAAAGCAAACTTCTAAACTTAAAGACATCATCCTGYGACACAATG[T/A]AAGTAAAAAATAAAATAAAAAAAATACTGACTAGACAGTAGTGATGGGTA
Long Flanking Sequence:
GTTAAACTTTTGTAAGGGTGTCTTTGCTTTCACCTTTGATTTTAAGTTAATGCATGCAATAGTATATGTGAATGTTTTTACATTTGATATTAAGATATTAATGTCAGTTTTACAGAGATGCAATATTTTGGTCAACACACTAGCCCTCACTAATAATAAATTTAAGCTTTCAATAAATATGATGTCTCTTTTATCTCATACTCTGTGTATGTGTGTTTTTTTTTTTTAAAGGAGGCGCTTCGATCTGCAGAATCCATCCAGACTGGATCGCAATACAGAGATGCTGGGCTGTGTGGAGAAAACGCTGATGCAGGTATTTGTGTTTGGATCTTTAGCTAAGACAAACATCATGAGCAAATCTGTGTGTGGTGCAGTATCTGACATTTGTCTTCTGTGTTTGTGTTAGAATAACTTATTAAGCAGACCTGTGGTGTACCTTTCCCCGGATCTGGAACAAAAGCAAACTTCTAAACTTAAAGACATCATCCTGCGACACAATG[T/A]AAGTAAAAAATAAAATAAAAAAAATACTGACTAGACAGTAGTGATGGGTATTTAGAGATATTTTAATTTAAGTTACATGTACTAGTTAAAAGAATCGTAATATTTAGCAATAGGTGTGACATTTTATATTAGATTTTAATTATTTCAAAAATCTAATATAAGTTCAAATATCCCCTTAAAAGTTATATTGTTTATTAAAAGTTACTTAAAAGTTATTATTGTTTATTTTGTATTATTACAATTACTGGCCACTTTATTTGGTACACCTTACTTGTACCCGGTTAGACCCCCTTCAGAACTGCTTTCATCCATTGTGGCATAGATTCAGCAAGGTACTGAAAATATTCCTCAGAGATTTTGGTCCATATTGACATGAGGGCATCATGCAGTTGCTGGAGATTTGACAGCTGCACACCCATGATGCAAATCTCCCATTCCACCACATCTCAATCTAATAGAGCACCTTTGGAATCTGGTGAAAATGGGGGCCATTTGAGAAG
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa23497
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085619 Essential Splice Site 300 961 9 29
ENSDART00000104385 Essential Splice Site 298 959 9 27
ENSDART00000130233 Essential Splice Site 298 322 9 11
ENSDART00000133978 None None 410 None 10
Genomic Location (Zv9):
Chromosome 19 (position 18954143)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 19799344
GRCz11 19 19372297
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAACGGGAATAGTTTGCGTTTTCGGCGACGGATCTACCAAAATACTGAAG[T/C]ATGTTTATCTAATAATTTGATTACATACCATGTTTAACCCTTTCACATTT
Long Flanking Sequence:
TGGTTTAGACCAGTCATGCGATTGGATCAGCAAGTGATGGTGCACTGGGGCATGTGTCCAGACAGGTAGTGAAGGATTGCACAAACATTTTCTCACGCACTAAATGTTTGCATTGTAAATTGCGGCATTTTGCTTTGTGTTCTAATGATTGTATATGCTTTCCATATTTAATTTTTTTAGTTATGATTCGCTTATATCAGCAAGTGATGTAGATGCAGATGTTGAGGAACCTCCTAACCCTGACAGATGCTTGAAGGTGATATAATACTTTTAAAAACAATACTTTGATTTCCCATGATCCTCCAAAACGGATCATTAAACAATTGAGATTAGCTTTTCCTGATGACATTAAAACGTTAAATTTTTTTCCCCTCAGGTTAGTTCCAGATGGGTTCTCGACACGGATACATATAACGAGTGGATGAATGAAGAAGACTATGAGATTGACGAGAACGGGAATAGTTTGCGTTTTCGGCGACGGATCTACCAAAATACTGAAG[T/C]ATGTTTATCTAATAATTTGATTACATACCATGTTTAACCCTTTCACATTTACCTATTAAATACTCCTGCTCATTCCAATGGGAGTTTTTTTTAATGTAACCATTATTTAGAACAAATCGTTTTAATGCTTTCGTGGTGATGCATAAAGTTTATCATGTGACACACCACTACTCCAATGACATGCATATATACCCGATTTTGTTTATTTTTTAACTTCTTTGCCAATATTGACAAATGTCCCTGTACAAATGTAATTATATTGTGAGATATTTGGTATTCTGACTTTCAAAAATGAGTTAAAAATATTAATAATGGTCGAATTAGTTGACGGGGTAGTCACGATACTGAAAGTCAGTACCAATCGATACTGAAATTTTAAAAAAGCCCATTTTCTGCTAACATTTGAGCGCTATTGAGCACGTTCTTAAACTGTTGATTTTCCATTGGCTTCATGTGCTCAACAGAAATGACTGTGATTGGCTGTGAAGGTCATAAATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17040
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085619 Nonsense 514 961 17 29
ENSDART00000104385 Nonsense 512 959 17 27
ENSDART00000130233 None None 322 None 11
ENSDART00000133978 None None 410 None 10
Genomic Location (Zv9):
Chromosome 19 (position 18940172)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 19785407
GRCz11 19 19358360
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTACTGTAGGGTTCATTCTTTTTTGGAGCAGTGGGGATTGATAAATTAT[C/T]AGGTTGAYGCGGAGAGTCGCCCCCTCCCRATGGGCCCACCCCCAACACCA
Long Flanking Sequence:
TTTTACTCTGTGAAAGGACACCCATGAGCCCATACATCTGAACAGAGAGCAGGCTACACGCCTCGTTGTTCAAACAGAAAAACATAAGGCACCTTTGTTAGCAACATTTGCCATATTTTTACAAAAGGGACAGGAATAAGGTGGAGTGCATATTTTGTTTTGAGGCAGCAACAATGAAAGAACTAGTAATTAATAGTTTACATTAACACAAACATGAAAATATATTGGGTCAAATGATGGCACATTTAATAACAAATGTTGCATATTTTTTGAGAAAGTAGACACAGCAAAAACAAAATACAAAAAATACAAAAACAAAAAGTGCAAAAAAGTTAGTTTCATCTGATGTCACCTTTAAACCCCAAAGTCATGATTCTCAATTTATCCAGAACTTTGCTACTCTACTATGCATATTATATCATTTGTAAATAATTTATTAACCTTGTTATATGTACTGTAGGGTTCATTCTTTTTTGGAGCAGTGGGGATTGATAAATTAT[C/T]AGGTTGACGCGGAGAGTCGCCCCCTCCCGATGGGCCCACCCCCAACACCACACTTTAATGTTCTTACAGATGCACCCTCTGGACTAGTCCCACTACAGCACAGACCACTACAGGTGATGTATACAACTTTGACTGCACGTTGAGAAGCTTCAGTTTAGCTATTATAAAACAAAATGTTAAATCAAATTATGTGTGTTTGAAGGTTTCAGCTTCTCAGCATATGCTGCATTTCCCTGAGAAATCAAGAGAAAAACCATCTGACCTGCAGAACTTTGGTTTACGAAGTGACATTTATGCTAAGAAACATCCAAAGGTAAAAAAAAAAAATGCAAATTGTTTTATTTTAGAAGTGTTTAACACAGCTGTCTTGAATCTATTTGTTCAGCTGAACTTTGTGTTCTTATTTTCTGTTTTACTTTTTTTTTTATCTTTTAGAGTAAAGGTGCAAGTGCAGGGAGAGAATGGACAGAACAGGAAACACTCTTGCTGTTGGAGGTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14091
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085619 Nonsense 551 961 17 29
ENSDART00000104385 Nonsense 549 959 17 27
ENSDART00000130233 None None 322 None 11
ENSDART00000133978 None None 410 None 10
Genomic Location (Zv9):
Chromosome 19 (position 18940061)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 19785296
GRCz11 19 19358249
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCTTACAGATGCACCCTCTGGACTAGTCCCACTACAGCACAGACCACTA[C/T]AGGTGATGTATACAACTTTGACTGCACGTTGAGAAGCWTCAGTTTAGCTA
Long Flanking Sequence:
CATATTTTTACAAAAGGGACAGGAATAAGGTGGAGTGCATATTTTGTTTTGAGGCAGCAACAATGAAAGAACTAGTAATTAATAGTTTACATTAACACAAACATGAAAATATATTGGGTCAAATGATGGCACATTTAATAACAAATGTTGCATATTTTTTGAGAAAGTAGACACAGCAAAAACAAAATACAAAAAATACAAAAACAAAAAGTGCAAAAAAGTTAGTTTCATCTGATGTCACCTTTAAACCCCAAAGTCATGATTCTCAATTTATCCAGAACTTTGCTACTCTACTATGCATATTATATCATTTGTAAATAATTTATTAACCTTGTTATATGTACTGTAGGGTTCATTCTTTTTTGGAGCAGTGGGGATTGATAAATTATCAGGTTGACGCGGAGAGTCGCCCCCTCCCGATGGGCCCACCCCCAACACCACACTTTAATGTTCTTACAGATGCACCCTCTGGACTAGTCCCACTACAGCACAGACCACTA[C/T]AGGTGATGTATACAACTTTGACTGCACGTTGAGAAGCTTCAGTTTAGCTATTATAAAACAAAATGTTAAATCAAATTATGTGTGTTTGAAGGTTTCAGCTTCTCAGCATATGCTGCATTTCCCTGAGAAATCAAGAGAAAAACCATCTGACCTGCAGAACTTTGGTTTACGAAGTGACATTTATGCTAAGAAACATCCAAAGGTAAAAAAAAAAAATGCAAATTGTTTTATTTTAGAAGTGTTTAACACAGCTGTCTTGAATCTATTTGTTCAGCTGAACTTTGTGTTCTTATTTTCTGTTTTACTTTTTTTTTTATCTTTTAGAGTAAAGGTGCAAGTGCAGGGAGAGAATGGACAGAACAGGAAACACTCTTGCTGTTGGAGGTAATCCAGTCAAACGGTTTAAAGATTTATTAAATTTTTATGTACGTAAATTAAAGATTTGTAATCTAGACTTCAGCAGCAATAGTACTGGATGCATTTGACAATTATTTTTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29186
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085619 Nonsense 911 961 28 29
ENSDART00000104385 Nonsense 909 959 26 27
ENSDART00000130233 None None 322 None 11
ENSDART00000133978 Nonsense 360 410 9 10
Genomic Location (Zv9):
Chromosome 19 (position 18927810)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 19773045
GRCz11 19 19345998
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAGGCAGACCTTCCACCTGGAGCAGGTGAAATATGCAGAGCAGAAAGTG[C/T]GACAGAATGTGGAACAACAGCAGCCGCAGCAGCAAACTGGAGGCTCTCAG
Long Flanking Sequence:
ATCTTCATTGCAGTTGTTGTCTTAAATCGGTTCACTGTTTGAAGTGAATAGGATGATTGTCAAGAATGGTCTGTGGTCTGCAGTAATATGTATGGGGCTAATTTTATTTTAAATTTTTAACTTGGGTTGTTGTCTTGATGAGTGCTGCTATTGTGTGATTGTTGTGTGTATATAGTTGTTGTCTTAAATCCAGTGTTAAAGACAAATTTCCTTTCTGTGCAAATCAGAACAGACAAAAGTTTAAACTAAACTAATTTATATGATGAAAAACATAACATCAACTTAACCATAGCACTGGTGTATTGTTACACACCTTTTATTTACTCAAATTCCTAATTATTTAAGTTATGAAAGATCTTGTTGACTGTTAACTGCATTTTCAGTGTATTTAAATGTAATTTGATTTCTGTCTCTTGTAGCTTGAGCAGCAAAGACAGCAGTTACTCTCTGAGAGGCAGACCTTCCACCTGGAGCAGGTGAAATATGCAGAGCAGAAAGTG[C/T]GACAGAATGTGGAACAACAGCAGCCGCAGCAGCAAACTGGAGGCTCTCAGAGCAGCCCTACATTCAACCCTCTTCACCAAGGTACAGTTTATGTGCACTCACACATTGTATTAACTGGAAAAGAAGTCATCACACTGTCATAATTGCAGAAGAAAACATAAGAACATGCTTCGGGTGTCTGTCCACTGACTTAAAGCAGCACACTTTTTGATTGAGTTTTATTATATAAAAATAATTATATAATTATATGAGCGCAATGTTACCAAATTCTGTGAATCGTTACACCCCTATTCATAAGTAATTTAAAATAGGCAAATCAACCACAGTAAACATTTGCAATAAAGCATTATAAATTGTCTTCTAGTCACTCCACGGTCAGTCTTTGACAATTAATGGTATTCATGACGATAAAGCAACTGCAAAAAGTATCGACTACAAATATACACCTTGGTCCTACACCCTATGATGCTTTACCTGGTTTATCTGGAGGAACAGAACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43257
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085619 Essential Splice Site 938 961 28 29
ENSDART00000104385 Essential Splice Site 936 959 26 27
ENSDART00000130233 None None 322 None 11
ENSDART00000133978 Essential Splice Site 387 410 9 10
Genomic Location (Zv9):
Chromosome 19 (position 18927727)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 19772962
GRCz11 19 19345915
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAACTGGAGGCTCTCAGAGCAGCCCTACATTCAACCCTCTTCACCAAGG[T/C]ACAGTTTATGTGCACTCACACATTGTATTAACTGGAAAAGAAGTCATCAC
Long Flanking Sequence:
TAATATGTATGGGGCTAATTTTATTTTAAATTTTTAACTTGGGTTGTTGTCTTGATGAGTGCTGCTATTGTGTGATTGTTGTGTGTATATAGTTGTTGTCTTAAATCCAGTGTTAAAGACAAATTTCCTTTCTGTGCAAATCAGAACAGACAAAAGTTTAAACTAAACTAATTTATATGATGAAAAACATAACATCAACTTAACCATAGCACTGGTGTATTGTTACACACCTTTTATTTACTCAAATTCCTAATTATTTAAGTTATGAAAGATCTTGTTGACTGTTAACTGCATTTTCAGTGTATTTAAATGTAATTTGATTTCTGTCTCTTGTAGCTTGAGCAGCAAAGACAGCAGTTACTCTCTGAGAGGCAGACCTTCCACCTGGAGCAGGTGAAATATGCAGAGCAGAAAGTGCGACAGAATGTGGAACAACAGCAGCCGCAGCAGCAAACTGGAGGCTCTCAGAGCAGCCCTACATTCAACCCTCTTCACCAAGG[T/C]ACAGTTTATGTGCACTCACACATTGTATTAACTGGAAAAGAAGTCATCACACTGTCATAATTGCAGAAGAAAACATAAGAACATGCTTCGGGTGTCTGTCCACTGACTTAAAGCAGCACACTTTTTGATTGAGTTTTATTATATAAAAATAATTATATAATTATATGAGCGCAATGTTACCAAATTCTGTGAATCGTTACACCCCTATTCATAAGTAATTTAAAATAGGCAAATCAACCACAGTAAACATTTGCAATAAAGCATTATAAATTGTCTTCTAGTCACTCCACGGTCAGTCTTTGACAATTAATGGTATTCATGACGATAAAGCAACTGCAAAAAGTATCGACTACAAATATACACCTTGGTCCTACACCCTATGATGCTTTACCTGGTTTATCTGGAGGAACAGAACACATTCAAAGAAGCTTTGGCTACAGGTGTAAGACTAAAGCCTGGTTTATACATCTGCGTCGAGTGATCTGCGTGAATGTTTCTGG
Associated Phenotype:
Not determined