Busch Lab

ZMP

slc27a2

Ensembl ID:
ENSDARG00000036237
ZFIN ID:
ZDB-GENE-050706-104
Description:
solute carrier family 27 (fatty acid transporter), member 2 [Source:RefSeq peptide;Acc:NP_001020470
Human Orthologues:
SLC27A2, SLC27A5
Human Descriptions:
solute carrier family 27 (fatty acid transporter), member 2 [Source:HGNC Symbol;Acc:10996]
solute carrier family 27 (fatty acid transporter), member 5 [Source:HGNC Symbol;Acc:10999]
Mouse Orthologues:
Slc27a2, Slc27a5
Mouse Descriptions:
solute carrier family 27 (fatty acid transporter), member 2 Gene [Source:MGI Symbol;Acc:MGI:1347099]
solute carrier family 27 (fatty acid transporter), member 5 Gene [Source:MGI Symbol;Acc:MGI:1347100]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa30701 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa23199 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30701
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052638 Essential Splice Site 223 614 2 10
Genomic Location (Zv9):
Chromosome 18 (position 239549)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 66363
GRCz11 18 66363
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATCACCATGAAGAGCCCCGCCCTCTACATCTACACCTCCGGCACCACAG[G/A]TGAGCACAGCGATCCTGTGTGTGTGTGTGTGTGTGTGTTTCAGCTCTGCG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2994
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052638 Nonsense 440 614 7 10
Genomic Location (Zv9):
Chromosome 18 (position 235992)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 69920
GRCz11 18 69920
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCACAAATTAGCTCCATTCGAAGGCTACGCTAAAAACTCCACGCAGACW[G/T]AGAAGAARAGGCTGAGGGACGTCTTTCAGAGAGGAGACATGTACTTCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23199
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052638 Nonsense 537 614 9 10
Genomic Location (Zv9):
Chromosome 18 (position 233566)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 72346
GRCz11 18 72346
KASP Assay ID:
2261-1672.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCGGCGCTGCAGCTGACAGACGGGATGGAGTTTGACGGTTCTGCTGCTTA[T/A]GAACACATGAAGAACCTCCTGCCGGCGTACGCCAGACCGCGCTTCATCAG
Associated Phenotype:
Not determined