Busch Lab

ZMP

si:ch211-232m8.2

Ensembl ID:
ENSDARG00000036215
ZFIN ID:
ZDB-GENE-081107-21
Description:
Novel protein similar to vertebrate lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte
Human Orthologue:
LCP2
Human Description:
lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa) [Source:HGNC Symbo
Mouse Orthologue:
Lcp2
Mouse Description:
lymphocyte cytosolic protein 2 Gene [Source:MGI Symbol;Acc:MGI:1321402]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa22518 Essential Splice Site Available for shipment Available now
sa42420 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa42421 Nonsense Mutation detected in F1 DNA Not yet available
sa28340 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22518
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052605 Essential Splice Site 60 482 3 18
ENSDART00000131424 Essential Splice Site 60 405 3 15
Genomic Location (Zv9):
Chromosome 14 (position 35634493)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34163770
GRCz11 14 34504084
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGAATATGACTGATAAGGATCTTAAAATGTTTCCCACGCCACATATTCC[G/A]TAAGTATTAATCTCAACAAGAACAAATATCTCAGAAAGATGGCAAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42420
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052605 Essential Splice Site 88 482 6 18
ENSDART00000131424 None None 405 None 15
Genomic Location (Zv9):
Chromosome 14 (position 35637258)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34166535
GRCz11 14 34506849
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAATATGGTTTTGGACCCATTATATGCACAATCTAAAATGTTTATATTT[G/A]ATTTTCATTGTACAAAAGTAGAACCTACTTCAGGAGGTTGGGATTCTGAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19090
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052605 Essential Splice Site 106 482 6 18
ENSDART00000131424 Essential Splice Site 104 405 6 15
Genomic Location (Zv9):
Chromosome 14 (position 35637315)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34166592
GRCz11 14 34506906
KASP Assay ID:
2260-7761.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTGTACAAAAGTAGAACCTACTTCAGGAGGTTGGGATTCTGATGAATTC[G/T]TAAGTCTTGGTGTCACAGTTTTTTTTAAGTTCTTAAACATTTTGACAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42421
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052605 Nonsense 388 482 16 18
ENSDART00000131424 Nonsense 311 405 13 15
Genomic Location (Zv9):
Chromosome 14 (position 35639188)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34168465
GRCz11 14 34508779
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTGGGGCAAATATCACGAGGAGAGGCCGAAGTCTCACTAAGAAAAGTG[A/T]AAAAGGTGAGTGGTATCACATTTTTGATTTACCTTAAATATATCCCTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28340
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052605 Splice Site, Nonsense 441 482 17 18
ENSDART00000131424 Splice Site, Nonsense 364 405 14 15
Genomic Location (Zv9):
Chromosome 14 (position 35639529)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34168806
GRCz11 14 34509120
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTTGGAAACAAGGATGGATATTCCCTAGGAACAGGACTAAATGGCATC[G/T]AGGTAATGGCATCTGTTGATTTTGACAGAAATGTTTATCTTAAATATGTC
Associated Phenotype:
Not determined