Busch Lab

ZMP

tbc1d5

Ensembl ID:
ENSDARG00000036212
ZFIN ID:
ZDB-GENE-040426-1197
Description:
TBC1 domain family member 5 [Source:RefSeq peptide;Acc:NP_956905]
Human Orthologue:
TBC1D5
Human Description:
TBC1 domain family, member 5 [Source:HGNC Symbol;Acc:19166]
Mouse Orthologue:
Tbc1d5
Mouse Description:
TBC1 domain family, member 5 Gene [Source:MGI Symbol;Acc:MGI:1919488]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa43264 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa36824 Essential Splice Site Available for shipment Available now
sa23504 Nonsense Available for shipment Available now
sa6553 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa43263 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa43264
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111409 Essential Splice Site 33 533 3 18
ENSDART00000140711 Essential Splice Site 33 842 3 22
ENSDART00000111409 Essential Splice Site 33 533 3 18
ENSDART00000140711 Essential Splice Site 33 842 3 22
Genomic Location (Zv9):
Chromosome 19 (position 20912355)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20845735
GRCz11 19 20430058
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGAGACGGGTTATGACCCTCTACAAAACTATAACAGAAACAGAGACCG[T/C]AAGACACTTGATGCATTTACATGCAAATTAGAGGCCTTGCCATGTGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36824
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111409 Essential Splice Site 33 533 3 18
ENSDART00000140711 Essential Splice Site 33 842 3 22
ENSDART00000111409 Essential Splice Site 33 533 3 18
ENSDART00000140711 Essential Splice Site 33 842 3 22
Genomic Location (Zv9):
Chromosome 19 (position 20912355)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20845735
GRCz11 19 20430058
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGAGACGGGTTATGACCCTCTACAAAACTATAACAGAAACAGAGACCG[T/C]AAGACACTTGATGCATTTACATGCAAATTAGAGGCCTTGCCATGTGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23504
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111409 Nonsense 86 533 6 18
ENSDART00000140711 Nonsense 86 842 6 22
Genomic Location (Zv9):
Chromosome 19 (position 20911272)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20844652
GRCz11 19 20428975
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATGTGAAAGTATAGATTATAATGATGAGTTTCGATGATTCCAGCTTTA[T/A]CTGGACGTCCTACCAGAAGATAAGGCTCAATGGATCAGTCGAACCAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6553
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111409 Essential Splice Site 266 533 12 18
ENSDART00000140711 Essential Splice Site 266 842 12 22
Genomic Location (Zv9):
Chromosome 19 (position 20905747)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20839127
GRCz11 19 20423450
KASP Assay ID:
554-4841.1 (used for ordering genotyping assays)
KASP Sequence:
TGGAGACCGCAGAACCCTGGTTCAGCAGTTTTGAGCKGGAGGTCAGAAAG[G/A]TACTAAGCWTGATTTTAAATAATGTTTTGAACTTCAGCATCAAACTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43263
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111409 Essential Splice Site 266 533 12 18
ENSDART00000140711 Essential Splice Site 266 842 12 22
Genomic Location (Zv9):
Chromosome 19 (position 20905746)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20839126
GRCz11 19 20423449
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGACCGCAGAACCCTGGTTCAGCAGTTTTGAGCGGGAGGTCAGAAAGG[T/G]ACTAAGCATGATTTTAAATAATGTTTTGAACTTCAGCATCAAACTTGTTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29192
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111409 Nonsense 416 533 16 18
ENSDART00000140711 Nonsense 416 842 16 22
Genomic Location (Zv9):
Chromosome 19 (position 20901453)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20834833
GRCz11 19 20419156
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATTATTTTTGTCTTTTTTTTACTAGAATAATCCACGACCAGTAAATTAC[C/T]AGTTCCAGCAAAACCTTGACTACTACAAGACTCGTGGGGCTGACTTGGTT
Associated Phenotype:
Not determined